View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10311_low_8 (Length: 298)
Name: NF10311_low_8
Description: NF10311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10311_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 288
Target Start/End: Complemental strand, 48790191 - 48789922
Alignment:
| Q |
19 |
acatggaagggatcataaccatttctggcgacaatagaagcagtttgcaagtccaagtatttgagtatctcgctaacaaccaaatcatgtccgttctcag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48790191 |
acatggaagggatcataaccatttctggcgacaatagaagcagtttgcaagtccaagtatttgagtatctcgctaacaaccaaatcatgtccgttctcag |
48790092 |
T |
 |
| Q |
119 |
aagcgacgtaaagaggggtctccccctcgaggttctgctttgccaacaagtcctttgctgcctcatggttttgaagtagtatctctttgactttagtcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48790091 |
aagcgacgtaaagaggggtctccccctcgaggttctgctttgccaacaagtcctttgctgcctcatggttttgaagtagtatctctttgactttagtcaa |
48789992 |
T |
 |
| Q |
219 |
gttcccagcccgagcagctaaatgaatgggtaagtcaccacgtttcccaggtgattccttgctcttcttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48789991 |
gttcccagcccgagcagctaaatgaatgggtaagtcaccacgtttcccaggtgattccttgctcttcttc |
48789922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University