View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10312_low_12 (Length: 371)
Name: NF10312_low_12
Description: NF10312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10312_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 42530652 - 42530697
Alignment:
| Q |
156 |
tttctcaacatagacttgtatctttcccaaactttacacaatgttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
42530652 |
tttctcaacatagacttgtatctttcccacgcttcatacaatgttt |
42530697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University