View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10313_low_5 (Length: 238)
Name: NF10313_low_5
Description: NF10313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10313_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4034092 - 4034315
Alignment:
| Q |
1 |
cattgccattgaaaaaga-agtttcttgtaagttaaagaattcaaaacacaataagaatcacattgtgtttttcacttgcctcaatcatctatgacatga |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4034092 |
cattgccattgaaaaagagagtttcttgtaagttaaagaattcaaaacacaataagaatcacattgtgtttctcacttgcctcaatcatctatgacatga |
4034191 |
T |
|
| Q |
100 |
ctagggatgaaacaaaatatatacatgtgacgcatgtattcatggataaaactcagtagatacaaagacaaggtagcttaacgagtatctacggataaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4034192 |
ctagggatgaaacaaaatatatacatgtgacgcatgtatgcatggataaaactcagtagatacaaagacaaggtagcttaacgagtatctacggataaaa |
4034291 |
T |
|
| Q |
200 |
taactgaattttgtaaatatttga |
223 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
4034292 |
taactgaattttgtgcatatttga |
4034315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University