View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10313_low_6 (Length: 222)
Name: NF10313_low_6
Description: NF10313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10313_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 11 - 136
Target Start/End: Complemental strand, 18233773 - 18233648
Alignment:
| Q |
11 |
gagatgaagggagttccaatcgaagaaatgtcaaccgtatgggagaagcatccttattggagtgattttgttcaagcgaaacccaaacccaatgatcaag |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18233773 |
gagacgaagggagttccaatcgaagaaatgtcaaccgtatgggagaaacatccttattggagtgattttgttaaagcgaaacccaaacccaatgatcaag |
18233674 |
T |
 |
| Q |
111 |
agttagggcagctttagattcttaag |
136 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
18233673 |
agttagggcagcgttagattcttaag |
18233648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University