View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10315_low_5 (Length: 239)
Name: NF10315_low_5
Description: NF10315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10315_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 99 - 223
Target Start/End: Original strand, 47429901 - 47430025
Alignment:
| Q |
99 |
tagtgttaattgtttagtccaatagcttttgattctttgtatagtccctgtttttggtctctccacatgatcctatagtggtttttcacatcaagctgct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47429901 |
tagtgttaattgtttagtccaatagcttttgattctttgtatagtccctgtttttggtctctccacatgatcctatagtggtttttcacatcaagctgct |
47430000 |
T |
 |
| Q |
199 |
agaatattcacattgctccttctat |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47430001 |
agaatattcacattgctccttctat |
47430025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 47429803 - 47429836
Alignment:
| Q |
1 |
gttaaatgttcatgattcaagtcatcgcaatgag |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47429803 |
gttaaatgttcatgattcaagtcatcgcaatgag |
47429836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University