View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10315_low_5 (Length: 239)

Name: NF10315_low_5
Description: NF10315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10315_low_5
NF10315_low_5
[»] chr7 (2 HSPs)
chr7 (99-223)||(47429901-47430025)
chr7 (1-34)||(47429803-47429836)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 99 - 223
Target Start/End: Original strand, 47429901 - 47430025
Alignment:
99 tagtgttaattgtttagtccaatagcttttgattctttgtatagtccctgtttttggtctctccacatgatcctatagtggtttttcacatcaagctgct 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47429901 tagtgttaattgtttagtccaatagcttttgattctttgtatagtccctgtttttggtctctccacatgatcctatagtggtttttcacatcaagctgct 47430000  T
199 agaatattcacattgctccttctat 223  Q
    |||||||||||||||||||||||||    
47430001 agaatattcacattgctccttctat 47430025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 47429803 - 47429836
Alignment:
1 gttaaatgttcatgattcaagtcatcgcaatgag 34  Q
    ||||||||||||||||||||||||||||||||||    
47429803 gttaaatgttcatgattcaagtcatcgcaatgag 47429836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University