View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10315_low_6 (Length: 233)
Name: NF10315_low_6
Description: NF10315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10315_low_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 233
Target Start/End: Original strand, 42086412 - 42086624
Alignment:
| Q |
21 |
ttattttgcccctttgttatgtgtgagtccaagtcatatatatgttacaatggtcatacaaattaacaaggtggtagctaaagttataaaactagaaatg |
120 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086412 |
ttattttgcacctatgttatgtgtgagtccaagtcatatatatgttacaatggtcatacaaattaacaaggtggtagctaaagttataaaactagaaatg |
42086511 |
T |
|
| Q |
121 |
gtaaaatacatcacactgacacaagcaaatggatggaaaaggcatgcaagcgtgtgcattgcacaaaacagagaaattttcacattattccttcttcttc |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086512 |
gtaaaacacatcacactgacacaagcaaatgaatggaaaaggcatgcaagcgtgtgcattgcacaaaacagagaaattttcacattattccttcttcttc |
42086611 |
T |
|
| Q |
221 |
caaatctctaaac |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42086612 |
caaatctctaaac |
42086624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University