View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10316_low_5 (Length: 251)
Name: NF10316_low_5
Description: NF10316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10316_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 6965676 - 6965891
Alignment:
| Q |
23 |
tgcacttagagtatctc--atattcagctcagtttgtttttcattcaatcagaaaatgagaatcaatatttttctctttgatagtgttcttgaatgtttt |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6965676 |
tgcacttagagtatctctcatattcagctcagtttgtttttcattcaatcagaaaatgagaatcaatatttttctcgttgatagtgttcttgaatgtttt |
6965775 |
T |
|
| Q |
121 |
atctatgacagcagcactttctacaggtattcaagtgttaaactatnnnnnnnctttttatagaaatcatctatacagagcttttgtagagttaacccca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6965776 |
atctatgacagcagcactttctacaggtattcaagtgttaaactataaaaaaactttttatagaaatcatctatacagagcttttgtagagttaacccca |
6965875 |
T |
|
| Q |
221 |
cattttctcttctatg |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6965876 |
cattttctcttctatg |
6965891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University