View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10316_low_8 (Length: 246)
Name: NF10316_low_8
Description: NF10316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10316_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 75 - 231
Target Start/End: Complemental strand, 31565883 - 31565725
Alignment:
| Q |
75 |
taaggggttgaggaaaagtaagggcactttcgtcatttcattcccaaagatgaagaaaaggtgccaataattgtgttattttttatacccataaattgaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31565883 |
taaggggttgaggaaaagtaagggcactttcgtcatttcattcccaaagatgaagaaaaggtgccaataattgtgttattttttatatccataaattgaa |
31565784 |
T |
|
| Q |
175 |
acattctaccatattcatta--acactcataattggcaccttctgtaagctctttatga |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31565783 |
acattctaccatattcattaacacactcataattggcaccttttgtaagctctttatga |
31565725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 31565999 - 31565922
Alignment:
| Q |
1 |
aagaaacagcttcagttgttgttggaatttatgatggttatgggttttgaggttgaagagcaaaagaaagttgataag |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31565999 |
aagaaacagcttcagttgttgttggaatttatgatggttatgggttttgaggttgaagagcaaaagaaagttgataag |
31565922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University