View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_high_15 (Length: 378)
Name: NF10317_high_15
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 43 - 178
Target Start/End: Complemental strand, 10795400 - 10795253
Alignment:
| Q |
43 |
gcggacgttgggggttgctcctgatccactgaaagtcacatcaactggatacagattccccggcggtccagtcatgtatacatatggtgatgatgat--- |
139 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795400 |
gcggccgttgggggttgctcctgatccactgaaattcacatcaactggatacaggttccccggcggtccagtcatgtatacatatggtgatgatgatgat |
10795301 |
T |
|
| Q |
140 |
---------gatggtggtggaggacaatttgccgagggaggtttctta |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795300 |
gatggtgatgatggtggtggaggacaatttgccgagggaggtttctta |
10795253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 294 - 360
Target Start/End: Complemental strand, 10795137 - 10795071
Alignment:
| Q |
294 |
aatatattggagtgtcaccacatggtgcgcacttctcaactagctttcttgattccatagcattaat |
360 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10795137 |
aatatattggagtgtcaccacatggtgtgcacttctcaacaagctttcttgattccatagcattaat |
10795071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University