View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_high_17 (Length: 370)
Name: NF10317_high_17
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 272 - 341
Target Start/End: Original strand, 11247333 - 11247402
Alignment:
| Q |
272 |
tttatgagcattgtcatgctcaatttatttctttgcatttggttgatctgttgggagttgccatctctag |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11247333 |
tttatgagcattgtcatgctcaatttatttctttgcatttggttgatttgttgggagttgccatctctag |
11247402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University