View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_high_27 (Length: 285)
Name: NF10317_high_27
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 33 - 268
Target Start/End: Original strand, 43485263 - 43485505
Alignment:
| Q |
33 |
tgcatgatatgtaatcgtcgaagctattatttaaagatttaagcacaactattttttagtctaattttcatgataacgagtatttgagaagagacaaagg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43485263 |
tgcatgatatgtaatcgtcgaagctattatttaaagatttaagcacaactattttttagtctaattttcatgataccgagtatttgagaagagacaaagg |
43485362 |
T |
|
| Q |
133 |
aatgtcgttaagtgagctatttcatgcatacaacatcctctgagtatcactattgtagcaataaatttggtttgtttctaaagcttgacatggttaaaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43485363 |
aatgtcgttaagtgagctatttcatgcatacaacatcctctgagtatcactattgtagcaataaatttagtttgtttctaaagcttgacatggttaaaat |
43485462 |
T |
|
| Q |
233 |
cataatg-------atagactaacactttggcatgctcaatct |
268 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43485463 |
cataatgatacttcatagactaacactttggcatgctcaatct |
43485505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University