View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_low_32 (Length: 310)
Name: NF10317_low_32
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 13 - 293
Target Start/End: Complemental strand, 29817192 - 29816912
Alignment:
| Q |
13 |
agaagaagaaccaatattgttggactttaaagggaacatcaacatggtactccttgaagaagctgaagaggttatgctgttggcagcaacattaagtgac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29817192 |
agaagaagaaccaatattgttggactttaaagggaacatcaacatggtactccttgaagaagctgaagaggttgtgctgttggcagcaacattaagtgac |
29817093 |
T |
|
| Q |
113 |
aacaaaaatccagtagcggctgatgccatgctgctgctagccatgactatctttctgtgtgtgtctctcttttgataatcttaatgtggcaaaaggacaa |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29817092 |
aacaaaaatccagtagctgctgatgccatgctgctgctagccatgactatctttctgtgtgtgtctctcttttgataatcttaatgtggcaaaaggacaa |
29816993 |
T |
|
| Q |
213 |
gattagattgtagtttgagaggctttgagtgagtgaagtgtgttagtttggttgtttattttggaggagaatcatctcatc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29816992 |
gattagattgtagtttgagaggctttgagtgagtgaagtgtgttagtttggttgtttattttggaggagaatcatctcatc |
29816912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University