View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_low_36 (Length: 290)
Name: NF10317_low_36
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 115 - 271
Target Start/End: Original strand, 49474596 - 49474752
Alignment:
| Q |
115 |
ggaagcacaaatattcttataacaattcatttcctttgaaattaatccctgaacttaaaattctattataatccagaacaacttcatccacggcatactg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49474596 |
ggaagcacaaatattcttataacaattcatttcctttgaaattaatccctgaacttaaaattctattataatccagaacaacttcatccacggcatactg |
49474695 |
T |
|
| Q |
215 |
taactctgtaagattgtcaattgcatagatatcatatggtaacaagactattcaata |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49474696 |
taactctgtaagattgtcaattgcatagatatcatatggcaacaagactattcaata |
49474752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University