View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_low_38 (Length: 277)
Name: NF10317_low_38
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 33860126 - 33859884
Alignment:
| Q |
19 |
gagaggaagatcactgagtcagcattgatgaattgaatcgtgcaggatgatgatatggatgtatttgtggaaaaacaatatcagaagaggaagaagacct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
33860126 |
gagaggaagatcactgagtcagcattgatgaatggaatcgtgcaggatgatgatatggatgtatttgtggaaaaacaacatcagaagaggaaga---cct |
33860030 |
T |
|
| Q |
119 |
atgattctgctgtttagtattagttatgctgattagtataacagaaattttaaatttgaatttcagtattgctaggaacagattttacctattaagtagg |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33860029 |
ttgattctgctgtttaggattagttatgctgattagtataatagaatttttaaatttgaatttcagtattgctaggaacagattttacctattaagtagg |
33859930 |
T |
|
| Q |
219 |
attaattgttaggaagacctttgaatttctctctaggtgttctgtg |
264 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
33859929 |
attaattgttgggaagacctttgaatttctctctaggagttctgtg |
33859884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 154 - 213
Target Start/End: Complemental strand, 32867656 - 32867597
Alignment:
| Q |
154 |
gtataacagaaattttaaatttgaatttcagtattgctaggaacagattttacctattaa |
213 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||| | |||||||||||||||||||| |
|
|
| T |
32867656 |
gtataacagaatttttaaacttaaattacagtattgttgagaacagattttacctattaa |
32867597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 69 - 127
Target Start/End: Complemental strand, 32867753 - 32867697
Alignment:
| Q |
69 |
tgatatggatgtatttgtggaaaaacaatatcagaagaggaagaagacctatgattctg |
127 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
32867753 |
tgatacggatgcatttgtgggaaaacaatatcagaagagg--gaagacctttgattctg |
32867697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University