View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_low_51 (Length: 244)
Name: NF10317_low_51
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 692168 - 691944
Alignment:
| Q |
1 |
tgataatagtgcatgtgcgtagcttgaaaggaaagttcaactcttctacttcaagtaataggataacataaggcgttgtattctatctagttaattgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
692168 |
tgataatagtgcatgtgcgtagcttgaaaggaaagttcaactcttctacttcaagtaataggataacataaggcgttgtattcta----gttaattgaat |
692073 |
T |
 |
| Q |
101 |
aaatgtgcatttattgtttaatcaaagggaagattcttgtatgcttcctttacgggtcggtagtttgcttctttgaattttttctgagtttgaatacaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
692072 |
aaatgtgcatttattgtttaatcaaagggaagattcttgtatgcttcctttacgggtcggtagtttgcttctttgaattttttctgagtttcaatacaca |
691973 |
T |
 |
| Q |
201 |
ttacctatgctaactttctgtgcaaaata |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
691972 |
ttacctatgctaactttctgtgcaaaata |
691944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University