View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10317_low_52 (Length: 243)
Name: NF10317_low_52
Description: NF10317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10317_low_52 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 31 - 227
Target Start/End: Original strand, 15113 - 15309
Alignment:
| Q |
31 |
ggcttcttagggtatctcagtgtgtaatgaccaagactaattttcacacacaaatcggctcgaagccataaccacacatttagtgcatgtttggtattcg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15113 |
ggcttcttagggtatctcagtgtgtaatgaccaagactaattttcacacacaaatcagctcgaagccataaccacacatttagtgcatgtttggtattcg |
15212 |
T |
 |
| Q |
131 |
gtatcatggttaacatatcagagtcacagtgactcactgcaattctgacatacccattgtgatatcaaacatgcacttaaaatctaaattgcttctc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15213 |
gtatcatggttaacatatcagagtcacagtgactcactgcaattctgacatacccactgtgatatcaaacatgcacttaaaatctaaattgcttctc |
15309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University