View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_10 (Length: 258)
Name: NF10318_low_10
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 52585180 - 52585413
Alignment:
| Q |
18 |
agattgtgttaggatttaagagaactgatttgtgaaagagtatgtagccaaattttgggtttcaaataagtgttagcaacaagaaaccaagacaaagcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52585180 |
agattgtgttaggatttaagagaactgatttgtgaaagagtatgtagccaaattttaggtttcaaataagtgttagcaacaagaaaccaagacaaagcta |
52585279 |
T |
 |
| Q |
118 |
ggttgcagaactgtttttagctatttaactctaactactttatattggcttcgcacagttaagatgcaaacaaaattctagtaatagtttacacctcaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52585280 |
ggttgcagaactgtttttagctatttaactcaaactactttatattggcttcgcacagttaagatgcaaacaaaattctagtaatagtttacacctcaca |
52585379 |
T |
 |
| Q |
218 |
ccatgtttggaaacagtgttgcatttctctgctt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
52585380 |
ccatgtttggaaacagtgttgtatttctctgctt |
52585413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University