View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_12 (Length: 250)
Name: NF10318_low_12
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 71 - 233
Target Start/End: Original strand, 10258066 - 10258228
Alignment:
| Q |
71 |
aaatttggaaaatgatgtaggtggatctgaagctaaaaatttgccggggttcgtcagtgaggagaattttggttagagaagcaaatgaatattgtgcaac |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258066 |
aaatttggaaaatgatgtaggtggatctgaagctaaaaatttgccggggttcgtcagtgaggagaattttggttagagaagcaaatgaatattgtgcaac |
10258165 |
T |
|
| Q |
171 |
tcatgttatagttggaaaatctcaaggtcttattagaccaactatttctttacctaggtattg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258166 |
tcatgttatagttggaaaatctcaaggtcttattagaccaactatttctttacctaggtattg |
10258228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 10257997 - 10258041
Alignment:
| Q |
1 |
atagacaaaagttaatttaaagaaatatgtatgtatcaagtgcca |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10257997 |
atagacaaaagttaatttaaagaaatatgtatgtatcaagtgcca |
10258041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 86 - 187
Target Start/End: Original strand, 40376548 - 40376649
Alignment:
| Q |
86 |
tgtaggtggatctgaagctaaaaatttgccggggttcgtcagtgaggagaattttggttagagaagcaaatgaatattgtgcaactcatgttatagttgg |
185 |
Q |
| |
|
||||||||||||| || |||||||||||||| || || || |||| |||||||||||| |||||||||||| |||| |||| |||||||||| ||||| |
|
|
| T |
40376548 |
tgtaggtggatcttaaactaaaaatttgccgtggatcatcggtgaagagaattttggtacgagaagcaaatgcttattctgcatctcatgttattgttgg |
40376647 |
T |
|
| Q |
186 |
aa |
187 |
Q |
| |
|
|| |
|
|
| T |
40376648 |
aa |
40376649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University