View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_13 (Length: 247)
Name: NF10318_low_13
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 22608021 - 22608259
Alignment:
| Q |
1 |
ctttctttccacaacaagatgtttttgatttaacttcaagtaactttctcttcttttacatgtgttagtatagaaaaactatatagtatagtgtaatttt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
22608021 |
ctttctttccacaacaagatgttgttgatttaacttcaagtaactttctcttcttttacatgtgttggtatagaaaaactatatagtatagtataatttt |
22608120 |
T |
|
| Q |
101 |
gtttatttctaatctaaactgnnnnnnnnnnnnnnnngcaggttgtatgtttagtagtgtaaagtcgaacaatgttgttattggtggtagtaacatgcag |
200 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22608121 |
gtttatttctaatctaaact----tttttttttttttgcagattgtatgtttagtagtgtaaagtcgaacaatgttgttataggtggtagtaacatgcag |
22608216 |
T |
|
| Q |
201 |
tatgggacaacaatcaacatggttcatcatcttcttctctctc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22608217 |
tatgggacaacaatcaacatggttcatcatcttcttttctctc |
22608259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University