View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_15 (Length: 238)
Name: NF10318_low_15
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 2928726 - 2928502
Alignment:
| Q |
1 |
tgccttcccttttgactaagtctatcttgccactgcttacttgtgtttttcagtttgtttatttcaatttgttttcctttcagtggatatgtcattatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2928726 |
tgccttcccttttgactaagtctatcttgccactgcttacttgtgtttttcagtttgtttatttcaatttgttttcctttcagtggatatgtcattatct |
2928627 |
T |
|
| Q |
101 |
taatgactgaattatctaattattttgtctacaatattggctttctttacttttatctgatgaacatttggtctttataagacagcacttatggtttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2928626 |
taatgactgaattatctaattattttgtctacaatattggctttctttacttttatctgatgaacatttggtctttataagacagcacttatggtttgtt |
2928527 |
T |
|
| Q |
201 |
gaatttcactgtgttgatacaattg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2928526 |
gaatttcactgtgttgatacaattg |
2928502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 3014056 - 3014103
Alignment:
| Q |
1 |
tgccttcccttttgactaagtctatcttgccactgcttacttgtgtttt |
49 |
Q |
| |
|
||||||||||||||||||| ||| | ||| ||||||||||||||||||| |
|
|
| T |
3014056 |
tgccttcccttttgactaactct-tattggcactgcttacttgtgtttt |
3014103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University