View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_3 (Length: 394)
Name: NF10318_low_3
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 100 - 378
Target Start/End: Complemental strand, 25614542 - 25614264
Alignment:
| Q |
100 |
cttggccactaaagtaataaagatcgagcaaaaagacaagtaaatagcaaatgataaaatcaaagatggaaggaccacttgtggcagaaataattaagaa |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614542 |
cttggccactaaagcaataaagatcgagcaaaaaggcaagtaaatagcaaatgataaaatcaaagatggaaggaccacttgtggcagaaataattaagaa |
25614443 |
T |
 |
| Q |
200 |
tcattgacactgccacactactcaaaatggtcatataggttgcatgaaagctatgcacaaaaatagaaattattggttacgtgatcctgctacttgtagt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614442 |
tcattgacactgccacactactcaaaatggtcatataggttgcatgaaagctatgcacaaaaatagaaattattggttacgtgatcctgctacttgtagt |
25614343 |
T |
 |
| Q |
300 |
aatatttcaagtttcaacgttaattcaaaccaataattcatgtatacacgttaaaacaactttgtcactttccttaggt |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614342 |
aatatttcaagtttcaacgttaattcaaaccaataattcatgtatacacgttaaaacaactttgtcactttccttaggt |
25614264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University