View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_4 (Length: 391)
Name: NF10318_low_4
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 270
Target Start/End: Complemental strand, 41787992 - 41787733
Alignment:
| Q |
13 |
gagatgaatgaatgaaaaactgagacatatgtcgaatagggtccagagttggactacgtggttttacctgatagatatagtctgttataacnnnnnnnn- |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787992 |
gagacgaatgaatgaaaaactgagacatatgtcgaatagggtccagaggtggactacgtggttttacctgatagatatagtctgttataacttttttttt |
41787893 |
T |
 |
| Q |
112 |
-aggtgtgacttctttctattgtgatttccatggtggttcatgaaatttaacacgtggttcgttagtggaggagcaggatagatcaaatgagctcacaag |
210 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787892 |
taggtgtgacttctttctattgttagttccatggtggttcatgaaatttaacacgtggttcgttagtggaggagcaggatagatcaaatgagctcacaag |
41787793 |
T |
 |
| Q |
211 |
tatattcagtacattgctattttttctctttccttgccttagtcgtaagatatgcaaccc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787792 |
tatattcagtacattgctattttttctctttccttgccttagtcgtaagatatgcaaccc |
41787733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 272 - 373
Target Start/End: Complemental strand, 41787602 - 41787501
Alignment:
| Q |
272 |
caacttttctggataattgttaattgcaatcatagttttgttcacattgctaaatccattggattttcacataaaaaaggatgaaaaatgaagacagagt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787602 |
caacttttctggataattgttaattgcaatcatagttttgttcacattgctaaatccattggattttcacataaaaaaggatgaaaaatgaagacagagt |
41787503 |
T |
 |
| Q |
372 |
ta |
373 |
Q |
| |
|
|| |
|
|
| T |
41787502 |
ta |
41787501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University