View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_6 (Length: 355)
Name: NF10318_low_6
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 5173457 - 5173122
Alignment:
| Q |
1 |
ctcactacagaaagttaggctttggcttggaacattcgactcagccgaagaggcagctcgtgcttatgacactgctgctagagctttgagaggtgctaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173457 |
ctcactacagaaagttaggctttggcttggaacattcgactcagccgaagaggcagctcgtgcttatgacactgctgctagagctttgagaggtgctaat |
5173358 |
T |
|
| Q |
101 |
gcaagaaccaactttgaattgccagaatctgaaacaaatggtagtggaggttcaaagcgcggtgctggttccaaattcatgctagagaatacagaacctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173357 |
gcaagaaccaactttgaattgccagaatctgaaacaaatggtagtggaggttcaaagcgcggtgctggttccaaattcatgctagagaatacagaacctt |
5173258 |
T |
|
| Q |
201 |
tttcttttgaagatgtcagtgactcgggttcaggttcagaacacggtcttcttggtgcactcaaggcaaaactttttgacggaaaagaagggaaattttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173257 |
tttcttttgaagatgtcagtgactcgggttcaggttcagaacacggtcttcttggtgcactcaaggcaaaactttttgacggaaaagaagggaaattttc |
5173158 |
T |
|
| Q |
301 |
attttcatttccttctggtagcatggttacaaaatc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173157 |
attttcatttccttctggtagcatggttacaaaatc |
5173122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University