View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10318_low_8 (Length: 307)
Name: NF10318_low_8
Description: NF10318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10318_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 18 - 173
Target Start/End: Original strand, 22607720 - 22607875
Alignment:
| Q |
18 |
agaaacaagaacctctcttacattatgtgtgttatgttttagtacacaaacattcttaacacacattatcaatagttatgcaaagtttcaaaacagctca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22607720 |
agaaacaagaacctctcttacattatgtgtgttatgttttagtacacaaacattcttaacacacattatcaatagttatgcaaagcttcaaaacagctca |
22607819 |
T |
 |
| Q |
118 |
atcaaactctcaactctattgccaccaacccttcttgcttaggtatgtttgtgtag |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22607820 |
atcaaactctcaactctattgccaccaacccttcttgcttaggtatgtttgtgtag |
22607875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 199 - 307
Target Start/End: Original strand, 22607899 - 22608007
Alignment:
| Q |
199 |
attctcttgtgataaaaatggtttcatgctattttggttttttgatgaaacaaacagaggagaagacataaacagaaacacaatgcgtttttctgatatt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22607899 |
attctcttgtgataaaaatggtttcatgctgttttggttttttgatgaaacaaacagaggagaagacataaacagaaacacaatgcgtttttctgatatt |
22607998 |
T |
 |
| Q |
299 |
ggagacttt |
307 |
Q |
| |
|
||||||||| |
|
|
| T |
22607999 |
ggagacttt |
22608007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University