View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_high_13 (Length: 425)
Name: NF10319_high_13
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 136 - 338
Target Start/End: Complemental strand, 19695316 - 19695113
Alignment:
| Q |
136 |
gcttcttatcaacgaaggggttatcggtggatttatacattatgtaattcaaatgattgttttggcaaaagtaaaagccctatgnnnnnnnnnnnntt-g |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| || | |
|
|
| T |
19695316 |
gcttcttatcaacgaaggggttatcggtggatttatacattatgtaattgacatgattgttttggcaaaactaaaagccctataaaaaaaaaatattttg |
19695217 |
T |
|
| Q |
235 |
acatgaaaagaattaatgttttggcaaaagtgaaagccctataaatactagtatcaaagtaaaagtcatattcattgccatttctatttatttcttacaa |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19695216 |
acatgaaaagaattaatgttttggcaaaagtgaaagccctataaatactagtatcaaagtaaaagtcatattcgttgccatttctatttatttcttacaa |
19695117 |
T |
|
| Q |
335 |
ctac |
338 |
Q |
| |
|
|||| |
|
|
| T |
19695116 |
ctac |
19695113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 339 - 418
Target Start/End: Complemental strand, 19695017 - 19694938
Alignment:
| Q |
339 |
ttggctcataaaaataaaaggcatatctataatcttaacaacaaagaactcatattaattgttcaatactcttcatctct |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19695017 |
ttggctcataaaaataaaaggcatatctataatcttaacaacaaagaactcatattaattgttcaatactcttcatctct |
19694938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University