View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_high_22 (Length: 308)
Name: NF10319_high_22
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 15 - 280
Target Start/End: Original strand, 19597315 - 19597580
Alignment:
| Q |
15 |
taacaaggtggtcgtagtggccaatacggtaccatatcataatacagtgttcgaggtggctgtgatgaagaagatggtaccagcgacagatttgttggta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597315 |
taacaaggtggtcgtagtggccaatacggtaccatattataatacagtgttcgaggtggctgtgatgaagaagatggtaccagcgacagatttgttggta |
19597414 |
T |
 |
| Q |
115 |
gaatagaatgatatggtggtcgtggtggctgcggtgaagatggtgtattggattgtgatggtagctccgttaaagattgcgttcttcttcgcaggaatga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597415 |
gaatagaatgatatggtggtcgtggtggctgcggtgaagatggtgtattggattgtgatggtagctccgttaaagattgcgttcttcttcgcaggaatga |
19597514 |
T |
 |
| Q |
215 |
aaatggccttggtggcagtgaagattgatgtggctgcagtgaagatggtggtttctctgatgaaga |
280 |
Q |
| |
|
||| |||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597515 |
aaacggccttcgtggcaatgaagattgctgtggctgcagtgaagatggtggtttctctgatgaaga |
19597580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 19592817 - 19592874
Alignment:
| Q |
123 |
tgatatggtggtcgtggtggctgcggtgaagatggtgtattggattgtgatggtagct |
180 |
Q |
| |
|
|||||||||||| ||||| |||||| |||| |||||| ||||||||| |||||||||| |
|
|
| T |
19592817 |
tgatatggtggttgtggtcgctgcgttgaaaatggtgcattggattgggatggtagct |
19592874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University