View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_high_30 (Length: 255)
Name: NF10319_high_30
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 38038224 - 38038404
Alignment:
| Q |
16 |
atgaacatgaagtatgggccttgtatggggatgacgaggctggcacgcttggagcgtgctgtgaagcttggtttgaaccctccagaggaaatcgcggaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38038224 |
atgaacatgaagtatgggccttgtatggggatgacgaggctggcacgcttggagcgtgctgtgaagcttggtttgaaccctccggaggaaatcgcggaac |
38038323 |
T |
|
| Q |
116 |
tcttgaagagtggtaaagttcagcaagaatcactttgggacactcgcatttagaacgctgcttaaatgtaataatcttgtt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038324 |
tcttgaagagtggtaaagttcagcaagaatcactttgggacactcgcatttagaacgctgcttaaatgtaataatcttgtt |
38038404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 191 - 238
Target Start/End: Original strand, 38038419 - 38038466
Alignment:
| Q |
191 |
cttgtttgtttgtttaggttttgcttagggaaaatcagtttcttgctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38038419 |
cttgtttgtttgtttaggttttgcttagggaaaatcactttcttgctg |
38038466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University