View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_high_32 (Length: 241)
Name: NF10319_high_32
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_high_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 28232447 - 28232227
Alignment:
| Q |
19 |
agtggatcgtgatatcatagatatccatacaggtgaaaattgccctaaaaggattgtcacttgtgacttctgtgagttcccattgccagcaattgatcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28232447 |
agtggatcgtgatatcatagatatccatacaggtgaaaattgccctaaaaggattgtcacttgtgatttctgtgagttcccattgccagcaattgatcta |
28232348 |
T |
|
| Q |
119 |
gctgagcaccaggtagtgcttatgaagaactttgggttagaagannnnnnnnnnnnnnnnnnnngcactaattttagtttgtaattcataccttgtagga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232347 |
gctgagcaccaggtagtgcttatgaagaactttgggttagaaga--tttttgacatttttttttgcactaattttagtttgtaattcataccttgtagga |
28232250 |
T |
|
| Q |
219 |
agtatgcgggaatcgaacagaac |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28232249 |
agtatgcgggaatcgaacagaac |
28232227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 117
Target Start/End: Complemental strand, 52078188 - 52078120
Alignment:
| Q |
49 |
aggtgaaaattgccctaaaaggattgtcacttgtgacttctgtgagttcccattgccagcaattgatct |
117 |
Q |
| |
|
|||||||| |||||| | ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
52078188 |
aggtgaaagttgcccccagaggattgtcacctgtgagttctgtgagtttccattgcctgcaattgatct |
52078120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 45639816 - 45639750
Alignment:
| Q |
51 |
gtgaaaattgccctaaaaggattgtcacttgtgacttctgtgagttcccattgccagcaattgatct |
117 |
Q |
| |
|
|||||| |||||| | ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
45639816 |
gtgaaagttgcccccagaggattgtcacctgtgagttctgtgagtttccattgcctgcaattgatct |
45639750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University