View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_low_26 (Length: 322)
Name: NF10319_low_26
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 10 - 318
Target Start/End: Complemental strand, 41100488 - 41100180
Alignment:
| Q |
10 |
gaagcagagataagagacattcatcgcaccaccttaggcaaattatgaaagactcaacaacttggaggaggtatcttttggattccaactggcgaatcca |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41100488 |
gaagcacagataagagacattcatcgcaccaccttaggcaaattatgaaagactcgacaacttggaggaggtatcttttggattccaactggcgaatcca |
41100389 |
T |
 |
| Q |
110 |
gtcacgctcaatatcaaaaaatatgtgctcactttttggagggacgataaattttctagggaagactttgaagactacaatacacatttgacacatttca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41100388 |
gtcacgctcaatatcaaaaaatatgtgctcactttttggagggacgataaattttctagggaagactttgaagactacaatacacatttgacacatttca |
41100289 |
T |
 |
| Q |
210 |
tggaagtttgcggcactacaaatccttctagagcatctggataaacaagaggctaagattttttggttactcgctcacaacacgcgcaaaggattggctc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41100288 |
tggaagtttgcggcactacaaatccttctagagcatctggataaacaagaggctaagattttttggttactcgctcacaacacgcgcaaaggattggctc |
41100189 |
T |
 |
| Q |
310 |
aactcactt |
318 |
Q |
| |
|
||||||||| |
|
|
| T |
41100188 |
aactcactt |
41100180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University