View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_low_41 (Length: 246)
Name: NF10319_low_41
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 37434975 - 37434754
Alignment:
| Q |
10 |
gcaaagggagataccaattgtgtgagcacctgnnnnnnntttcaaattatggtcattaaagttaaaaccacatatttcaccattagaaaatgtcgaatca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
37434975 |
gcaaagggagataccaattgtgtgagcacctgaaaaaa-tttcaaattatggtcattaaagttaaaaccacatatttcaccactagaaaatgttgaatca |
37434877 |
T |
|
| Q |
110 |
gcgacgaaaattagagataagataaaatgaaataaaaatttgtcacaaattatttcatttttctgtctctaatttttgtcggtaacattttcttgtagtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434876 |
gcgacgaaaattagagataagataaaatgaaataaaaatttgtcacaaattatttcatttttctgtctctaatttttgtcggtaacattttcttgtagtg |
37434777 |
T |
|
| Q |
210 |
atttagcgtgcacgatgaaagtg |
232 |
Q |
| |
|
|||||||||| |||| ||||||| |
|
|
| T |
37434776 |
atttagcgtggacgacgaaagtg |
37434754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University