View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_low_49 (Length: 229)
Name: NF10319_low_49
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 40659214 - 40659012
Alignment:
| Q |
5 |
agaggagaagcatagggcaggctcaacttgggtggtgttttattcccgcttcagatatcggccttcttacacctggctcagttcggtacctgagttaccg |
104 |
Q |
| |
|
|||| |||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40659214 |
agagaagaatcatggggcaggctcaacttgggtggtgttttattccggcttcagatatcggccttcttacacctggctcagttcggtacctgagttaccg |
40659115 |
T |
|
| Q |
105 |
gctacgaggtaaagacggttccaggggacatgccataatcaacatctccgtcagattggagataacgacgttgatgtcatcgaacatggacacatgtcac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40659114 |
gctacgaggtaaagacggttccaggggacatgccataatcaacatctccgtcagattggagataacgacattgatgtcatcgaacatggacacatgtcac |
40659015 |
T |
|
| Q |
205 |
act |
207 |
Q |
| |
|
||| |
|
|
| T |
40659014 |
act |
40659012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University