View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_low_53 (Length: 227)
Name: NF10319_low_53
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_low_53 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 33554878 - 33554655
Alignment:
| Q |
1 |
gtgggggagctccagaagcattagatgttgcaaatcgaaatttgtttgtgtgagttcagtcgaaatttatatatgcaatgtatgaaactatactttcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554878 |
gtgggggagctccagaagcattagatgttgcaaatcgaaatttgtttgtgtgagttcagtc---atttatatatgcaatgtatgaaactatactttcatg |
33554782 |
T |
 |
| Q |
101 |
tcgnnnnnnnggttacatgggatgtagttcttacatgcttaagaacatatgttatattgacggtttctgtttctgtcctccactatatatttagttaata |
200 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554781 |
tcgtttttttggttacatgggatgtagatcttacatgcttaagaacatatgttatattgacggtttctgtttctgtcctccactatatatttagttaata |
33554682 |
T |
 |
| Q |
201 |
agcatacttttgttttgacaaaataca |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33554681 |
agcatacttttgttttgacaaaataca |
33554655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University