View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10319_low_57 (Length: 222)
Name: NF10319_low_57
Description: NF10319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10319_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 25 - 174
Target Start/End: Original strand, 33554497 - 33554647
Alignment:
| Q |
25 |
cattatgttcgtccgagtgaaactagactcgaatctcttaaataatgtctcaaatttaaactttgtaaatgg-aaaaaattacgtagttgacaagagaga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
33554497 |
cattatgttcgtccgagtgaaactagactcgaatctcttaaataatgtctcaaatttgaactttgtaaatggaaaaaaattacgtaattgacaagagaga |
33554596 |
T |
|
| Q |
124 |
ctctactatagatgaatatgttcttcaactaagattaatcaccgacaaaac |
174 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||| ||||||| |
|
|
| T |
33554597 |
ctctactatagatgaacatgttcttcaactaagattaatgaccaacaaaac |
33554647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University