View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1031_high_4 (Length: 266)
Name: NF1031_high_4
Description: NF1031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1031_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 39054786 - 39054956
Alignment:
| Q |
1 |
gatgcaatcaactactctttttcagtatataactctttacatgccccatccactaaatgttatacctctactggaattttgaaatttgttgcaggttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39054786 |
gatgcaatcaactactctttttcagtatataattctttacatgccccatccactaaatgttatacctctactggaattttgaaatttgttgcaggttaga |
39054885 |
T |
|
| Q |
101 |
gtctgcagggaaaagactacagatcatgtatatgcaatgaaaaagctaaagaaatcggagatgcttcgaag |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39054886 |
gtctgcagggaaaagactacagatcatgtatatgcaatgaaaaagctaaagaaatcggagatgcttcgaag |
39054956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 88 - 168
Target Start/End: Complemental strand, 30394526 - 30394446
Alignment:
| Q |
88 |
gttgcaggttagagtctgcagggaaaagactacagatcatgtatatgcaatgaaaaagctaaagaaatcggagatgcttcg |
168 |
Q |
| |
|
||||||||| ||||| ||||| || |||||||| ||| |||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30394526 |
gttgcaggtcagagtttgcagagagaagactactgattctgtatacgcaatgaaaaaactaaagaaatcagagatgcttcg |
30394446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 114 - 167
Target Start/End: Original strand, 19700217 - 19700270
Alignment:
| Q |
114 |
agactacagatcatgtatatgcaatgaaaaagctaaagaaatcggagatgcttc |
167 |
Q |
| |
|
||||||| | ||||||| | ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
19700217 |
agactactggtcatgtacaagcaatgaaaaagctaaagacatcagagatgcttc |
19700270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University