View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1031_high_6 (Length: 251)
Name: NF1031_high_6
Description: NF1031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1031_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 36883611 - 36883852
Alignment:
| Q |
11 |
catccttagcta--gcacctaataaagtgcaacccccttcaggcttcatgccagaacatttcaatcggtgcaagttatgaaaagaatcagaacttaaaag |
108 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36883611 |
catccttagctattgcacctaataaagtgcaacccccttcaggcttcatgccagaacatttcaatcggtgcaagttatgaaaagaatcagaacttaaa-g |
36883709 |
T |
 |
| Q |
109 |
ttaaaaccacccaaaagataataaaacttctggtaattaaactattgctcaatgccagttacaactttagccactagaatctttgcagtgacttactgga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36883710 |
ttaaaaccacccaaaagataataaaacttctggtaattaaactattgctcaatgccagttacaactttagccactagaatctttgcagtgacttactgga |
36883809 |
T |
 |
| Q |
209 |
aatttaacttgattgctcttcatgaatggtctcaaaatagcca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36883810 |
aatttaacttgattgctcttcatgaatggtctcaaaatagcca |
36883852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University