View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1031_low_13 (Length: 254)
Name: NF1031_low_13
Description: NF1031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1031_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 35762835 - 35763078
Alignment:
| Q |
1 |
caaacaaataatgtttcatacttgttattagcttatattagttctcaagtttattacatgtcatcttgtattataactactattattattatattaatga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762835 |
caaacaaataatgtttcattcttgttattagcttatattagttctcaagtttattacatgtcatcttgtattataactactattattattatattaatga |
35762934 |
T |
 |
| Q |
101 |
aatcagttgagtttgtttttctnnnnnnnncaacttatttatagttttttggaagnnnnnnnctaattatatggatcttgtattttctattttttaagat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762935 |
aatcagttgagtttgtttttctaaaaaaagcaacttatttatagttttttggaagaaaaaaactaattatatggatcttgtattttctattttttaagat |
35763034 |
T |
 |
| Q |
201 |
tgattgccgtaaaaaataagggtaaatgatcattttcgtctctg |
244 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35763035 |
tgactgccgtaaaaaataagggtaaatgatcattttcgtctctg |
35763078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 88
Target Start/End: Complemental strand, 29468319 - 29468284
Alignment:
| Q |
53 |
attacatgtcatcttgtattataactactattatta |
88 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29468319 |
attacatgtcatcttgtattacaactactattatta |
29468284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University