View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1031_low_17 (Length: 201)
Name: NF1031_low_17
Description: NF1031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1031_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 23 - 180
Target Start/End: Original strand, 41034699 - 41034856
Alignment:
| Q |
23 |
aggaggagcagagacaaatgatcattttactgatcagagaagcaacaaaaggttcacggagccaaccatatcaagcaatgctggattagttgcagcattg |
122 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41034699 |
aggaggaccagacacaaatgatcattttactgatcagaggagcaacaaaaggttcacggagccaaccatatcaagcaatgctggattagtttcagcattg |
41034798 |
T |
 |
| Q |
123 |
attgcacttcaagacccttctaataattcacatgacttgaaaaactcattgtgggaat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41034799 |
attgcacttcaagacccttctaataattcacatgacttgaaaaactcattgtgggaat |
41034856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University