View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1031_low_3 (Length: 412)
Name: NF1031_low_3
Description: NF1031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1031_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 30 - 301
Target Start/End: Complemental strand, 27445887 - 27445619
Alignment:
| Q |
30 |
ctcacatcctttggtcctgctaccacatcatcacttaatgccactagagcattagatgctacccccacgaagctagaaatttttatgttggtagggacga |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27445887 |
ctcacatcctttggtcccgctaccacatcatcacttaatgccactagtgcattagatgctacccccacgaagctagaaatttttatgttggtagg---ga |
27445791 |
T |
|
| Q |
130 |
tcaactcttctannnnnnnngcctagctcttagggttagaagcggctaattttttctccgttgatataagctttgatgaacaaaggtttaagatgtttta |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27445790 |
tcaactcttcta-tttttttgcctagctcttagggttagaagcggctaattttttctccgttgatataagctttgatgaacaaaggtttaagatgtttta |
27445692 |
T |
|
| Q |
230 |
cca-nnnnnnnnnnnngagtgggtttttcaaacagcacaccttcaatatccttttccttagtcgatgtggtct |
301 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27445691 |
ccatttttttttttttgagtgggtttttcaaacagcacaccttcaatatccttttccttagccgatgtggtct |
27445619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University