View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10320_high_1 (Length: 558)
Name: NF10320_high_1
Description: NF10320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10320_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 21 - 370
Target Start/End: Complemental strand, 39814938 - 39814589
Alignment:
| Q |
21 |
atgatcaagaagattctaaacttgaggttctcatcacaggttgcagcggaggaggaataggtaacgcgcttgcacgctccttcgcagccaacagctgcaa |
120 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39814938 |
atgatcaagaagattcaaaacctgtggttctcatcacaggttgcagcggaggaggaataggtaacgcgcttgcacgctccttcgcagccaacagctgcaa |
39814839 |
T |
 |
| Q |
121 |
tgtggttgcaaccagcaggtcatgttctaccatggcggatttggatcaagaccctaaattcttccttcaagaactcgatgttcagtccgatgcaagcgtg |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39814838 |
tgtggttgcaaccagcaggtcacgttctaccatggcggatttggatcaagaccctaaattcttccttcaagaactcgatgttcagtccgatgaaagcgtg |
39814739 |
T |
 |
| Q |
221 |
aacagagttgtgaatattgttttggataaatttggtcgcatcgatgttcttgttaataacgctggtgttccttgtacgggcccacttgctgaggttcctc |
320 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39814738 |
aacagagttgtgaatactgttttggataaatttggtcgcatcgatgttcttgttaataacgctggtgttccttgtacaggcccacttgctgaggttcctc |
39814639 |
T |
 |
| Q |
321 |
tctctgcgatccaaaacacgtttaatactaacgtctttggttggtaattc |
370 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39814638 |
tctctgcgatacaaaacacgtttaatactaacgtctttggttggtaattc |
39814589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 21 - 362
Target Start/End: Complemental strand, 39818462 - 39818121
Alignment:
| Q |
21 |
atgatcaagaagattctaaacttgaggttctcatcacaggttgcagcggaggaggaataggtaacgcgcttgcacgctccttcgcagccaacagctgcaa |
120 |
Q |
| |
|
||||||| |||||||| |||| | |||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39818462 |
atgatcacgaagattcgaaaccggtggttctcatcacaggttgcactggaggaggtataggtaacgcgcttgcacgctcctttgcagccaacagctgcag |
39818363 |
T |
 |
| Q |
121 |
tgtggttgcaaccagcaggtcatgttctaccatggcggatttggatcaagaccctaaattcttccttcaagaactcgatgttcagtccgatgcaagcgtg |
220 |
Q |
| |
|
|| |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
39818362 |
agttgttgcaaccagcaggtcacgttcaaccatggcggatttggatcaagaccctaaattcttccttcaagaactcgatgttcagtctgatgaaagcgtg |
39818263 |
T |
 |
| Q |
221 |
aacagagttgtgaatattgttttggataaatttggtcgcatcgatgttcttgttaataacgctggtgttccttgtacgggcccacttgctgaggttcctc |
320 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
39818262 |
aacagagttgtgaataatgttctggataaatttggtcgtatcgatgttcttgttaataacgctggtgttccttgtgtgggcccacttgctgaaattcctc |
39818163 |
T |
 |
| Q |
321 |
tctctgcgatccaaaacacgtttaatactaacgtctttggtt |
362 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
39818162 |
tctctgcgattcaaaacacgtttgaaactaacgtctttggtt |
39818121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 448 - 541
Target Start/End: Complemental strand, 39814511 - 39814418
Alignment:
| Q |
448 |
ggaaatagttatatttgtaacagcacatttctgtttgaaggcttgtcccggttttagaaacgtactagtgttcagtgttccacaccctcacgac |
541 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39814511 |
ggaaatagttatgtttgtaacagcacatttctgtttgaaggcgtgtcccggttttagaaacgtactagtgttcagtgttccacaccctcacgac |
39814418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University