View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10320_high_9 (Length: 240)
Name: NF10320_high_9
Description: NF10320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10320_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 45360643 - 45360843
Alignment:
| Q |
8 |
cttctcattattaaatggttgataatatatataatatgcaaggccttttgaagtgaatgatagcatcaaagttgtgcttatatagatacaagtgatgaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360643 |
cttctcattattaaatggttgataatat----aatatgcaaggccttttgaagtgaatgatagcatcaaagttgtgcttatatagatacaagtgatgaat |
45360738 |
T |
|
| Q |
108 |
tggaatagttggattgtttgctcaactgatgaatttaaaattgaaattaaattaaggccatatcttgataattccaatacttcaatatggactagctaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360739 |
tggaatagttggattgtttgctcaactgatgaatttaaaattgaaattaaattaaagccatatcttgataattccaatacttcaatatggactagctaat |
45360838 |
T |
|
| Q |
208 |
tcttc |
212 |
Q |
| |
|
||||| |
|
|
| T |
45360839 |
tcttc |
45360843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University