View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10320_low_1 (Length: 575)
Name: NF10320_low_1
Description: NF10320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10320_low_1 |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0458 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (2 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 344; Significance: 0; HSPs: 51)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Original strand, 35842598 - 35842978
Alignment:
| Q |
1 |
tgaggttcaaatcccattctttcacttggatgtgtaagtttccaataattattttgatgagttgagcggacttggacaacaactccttcatttcattaga |
100 |
Q |
| |
|
||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35842598 |
tgaggttcaaatctcattctttcacttcggtgtgtaagtttccaataattattttgatgagttgagcggacttggataacaactccttcatttcattaga |
35842697 |
T |
 |
| Q |
101 |
ggaagatgatgtaccagcaagtactacgatgagcaaataaaaaagcctcatacaagtgatgtttttatggtagaaaagtgtgtgtatctcaatacat--- |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35842698 |
ggaagatgatgtaccagcaagtactacgatgagcaaataaaaaagcctcatacaagtgatgtttttatggtagaaaagtgtgtgtatctgaatacatgct |
35842797 |
T |
 |
| Q |
198 |
-gctacgagggttttggggtctctcaaactctattttggacaactatctgaaggtgagcagattagaacaagttgatatggaatttgaaagaaacaatcc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35842798 |
agctacgagggttttggggtctctcaaactctattttggacaactatctgaaggtgagcagattagaacaagttgatatggaatttgaaagaaacaatcc |
35842897 |
T |
 |
| Q |
297 |
atattgattcagcggccctgcttacatgcatataggggaagtccttgagatagtttatatcatatgctagctagaaccaat |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35842898 |
atattgattcagcggccctgcttacatgcatataggggaagtccttgagatagtttatatcatatgctagctagaaccaat |
35842978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 426 - 532
Target Start/End: Original strand, 35843117 - 35843223
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacgactaagattaataggcaatat |
525 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35843117 |
atggtggccggggtttgaaccccggaccttacatatttttatgcattgtcataccaactaagttaaactcacgaggacgactaagattaataggcaatat |
35843216 |
T |
 |
| Q |
526 |
atataag |
532 |
Q |
| |
|
||||||| |
|
|
| T |
35843217 |
atataag |
35843223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 20665354 - 20665431
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
20665354 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
20665431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 30550717 - 30550794
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
30550717 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
30550794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 44215466 - 44215543
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
44215466 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
44215543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 429 - 498
Target Start/End: Original strand, 11040412 - 11040480
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacg |
498 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
11040412 |
gtggtcggggtttgaacttcggaccttacata-ttttatgcattgtccaatcaactgagttaagctcacg |
11040480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 19260570 - 19260646
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||| ||| || |||||||| |
|
|
| T |
19260570 |
tggtggccggggtttgaaccccggaccttacata-tattatgcattgtacatatcaactaagctaaacttacgaggac |
19260646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 19163527 - 19163605
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||| |||| ||||| || ||||||||||||||||| |
|
|
| T |
19163527 |
tggtggtcggggtttgaaccccggaccttgcata-aattatgcattgtccataccaactgagctaagctcacgaggacga |
19163605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 27718885 - 27718961
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||| || |||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
27718885 |
tggtggtcggagtttgaactccggaccttgcatatatt-atgcattgtccatatcaactgagctaagctcacgaggac |
27718961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 26886042 - 26886109
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
26886042 |
gggttcgaaccccggatcttacata-ttttatgcattgtccataccaactaagttaaactcacgaggac |
26886109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 491
Target Start/End: Original strand, 44632176 - 44632239
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaa |
491 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| | ||||||||||||||| ||||| |||||| |
|
|
| T |
44632176 |
tggtggtcggggtttgaaccccgaaccttatata-tattatgcattgtcataccaactgagttaa |
44632239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 426 - 499
Target Start/End: Original strand, 1764944 - 1765017
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||| |||||| |||||||||| ||| |||||||| |||| |||| |||||||||| |||||||||||||| |
|
|
| T |
1764944 |
atggtggttggggttcgaaccccggatcttgcatatttt-atgcgttgttcatatcaactgagttaagctcacga |
1765017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 436 - 501
Target Start/End: Complemental strand, 1922378 - 1922312
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacgagg |
501 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||||| |||||||| || || |||||||||| |
|
|
| T |
1922378 |
gggttcgaaccccggaccttgcatatatttatgcattgtcactatcaacttagctatgctcacgagg |
1922312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Original strand, 12251554 - 12251624
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
12251554 |
cggggttcaaaccccggacctgacatatatttgtgcattgttcctatcaactgagttaagctcacgaggac |
12251624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 21557504 - 21557427
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| || ||||| ||||||||||||| | ||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
21557504 |
atggtggtcgggattcgaacctcggaccttacata-tattatgcattgtccatactaactgagttaagctcacgaggac |
21557427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 429 - 475
Target Start/End: Original strand, 34645078 - 34645124
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcattgtc |
34645124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 34997522 - 34997452
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||| |||||| ||||| ||||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
34997522 |
cggggttcgaacccatgaccttgcatatatttatgcattgtctatatcaactgagctaagctcacgaggac |
34997452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 39443654 - 39443584
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
39443654 |
cggggttcaaaccccggacctgacatatatttgtgcattgttcctatcaactgagttaagctcacgaggac |
39443584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 16704518 - 16704441
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||||||||| || ||| || ||||||||| |||| || || || ||||||||||||||| |
|
|
| T |
16704518 |
tggtggccggggtttgaaccccggacctcacttatattcatgcattgtccataccagctgagctaagctcacgaggac |
16704441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 429 - 474
Target Start/End: Original strand, 24023408 - 24023452
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
24023408 |
gtggtcggggtttgaaccccggaccttgcata-ttttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 29376971 - 29376895
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||| || |||||| |||| | ||| ||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
29376971 |
tggtggtcggggtttgaactccagaccttgcata-tattacgcattgtccataccaactgagttaagctcacgaggac |
29376895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 498
Target Start/End: Original strand, 1135384 - 1135456
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||||| || |||||||||| |||||||||||| |||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
1135384 |
tggtggtctggatttgaaccccaaaccttacatattattatgcattgttcatacaaactgagttaagctcacg |
1135456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 24838161 - 24838208
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
24838161 |
tggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
24838208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 433 - 499
Target Start/End: Complemental strand, 1921785 - 1921718
Alignment:
| Q |
433 |
tcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||||| |||||||| || ||| ||||||| |
|
|
| T |
1921785 |
tcggggttcgaaccccggaccttgcatatatttatgcattgtcgctatcaacttagctaaactcacga |
1921718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 450 - 500
Target Start/End: Complemental strand, 44655042 - 44654991
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
44655042 |
gaccttgcatatatttatgcattgtctatatcaactaagctaagctcacgag |
44654991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 574455 - 574378
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||| | |||||||||||| ||||||||| || ||||||||| ||||| |
|
|
| T |
574455 |
atggtggtcgaagttcgaactccggaccttacata-tattatgcattgtctatatcaactgagctaagctcacaaggac |
574378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 475
Target Start/End: Original strand, 8461829 - 8461874
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
8461829 |
gtggtcggggtttgaactccggaccttgcata-ttttatgcattgtc |
8461874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 11709057 - 11708980
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
11709057 |
atggtggtcggggtttgaacttcggaccttgcata-tattatgcattgtccctaccaactgagctaagctcacgaggac |
11708980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Original strand, 12800891 - 12800925
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12800891 |
tggtggtcggggtttgaaccccggaccttgcatat |
12800925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 450 - 503
Target Start/End: Complemental strand, 15310370 - 15310316
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||| ||||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
15310370 |
gaccttgcatatatttatgcattgtctatatcaactgagctaagctcacgaggac |
15310316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 450 - 503
Target Start/End: Complemental strand, 15490739 - 15490685
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||| ||||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
15490739 |
gaccttgcatatatttatgcattgtctatatcaactgagctaagctcacgaggac |
15490685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 28581014 - 28580941
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcatt-gtcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| ||||||||||| ||||| ||||| || ||||||||||| |
|
|
| T |
28581014 |
tggtggtcgggatttgaaccccgaaccttacata-ttttatgcattattcataccaactgagccaagctcacgag |
28580941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Original strand, 1644664 - 1644736
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||| || |||||| ||| ||||||||||| |||||||||||| ||||| ||||| || ||||||||||| |
|
|
| T |
1644664 |
tggtggtcaggatttgaatcccagaccttacata-ttttatgcattgctcataccaactgagctaagctcacga |
1644736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 7997010 - 7996934
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| | |||||| |||| |||| ||||| || ||||||||| ||||| |
|
|
| T |
7997010 |
tggtggtcggggtttgaaccccagaccttgcata-tattatgcgttgtccataccaactgagctaagctcacaaggac |
7996934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 455
Target Start/End: Original strand, 10171560 - 10171589
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggacctt |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10171560 |
atggtggtcggggtttgaaccccggacctt |
10171589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 13357432 - 13357508
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| || |||||||||| || ||||| ||||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
13357432 |
tggtggccgaggtttgaacctcgtaccttgcatatatt-atgcattgtccataccaactgagttaagctcacgaggac |
13357508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 22775698 - 22775622
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||| ||||||||||| || | |||||||| ||||||||||||||| |
|
|
| T |
22775698 |
tggtggccagggtttgaaccccggaccttgcata-aattatgcattgtccaaaccaactaagctaagctcacgaggac |
22775622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Complemental strand, 26799254 - 26799182
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||| ||||||||||||| | || ||||| ||||||||| |||| |
|
|
| T |
26799254 |
tggtggtcggggttttaaccccgaaccttgcata-ttttatgcattgtccctaccaactgagttaagcttacga |
26799182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 27587291 - 27587215
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | | ||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
27587291 |
tggtggccggggtttgaaccccggaccttgcata-tatcatgcattgtccttaccaactgagctaagctcacgaggac |
27587215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 29293247 - 29293171
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||| | |||| |||||| |||| |||| |||||||||||||||||| |
|
|
| T |
29293247 |
tggtggccggagtttgaactccggaccttacata-tattatatattgtctatattaactgagttaagctcacgaggac |
29293171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 495
Target Start/End: Original strand, 32944831 - 32944899
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctc |
495 |
Q |
| |
|
|||||||||||||||||||| | |||||| |||| ||||||||||||| |||| ||||| ||||| |||| |
|
|
| T |
32944831 |
tggtggtcggggtttgaacctcagaccttgcata-ttttatgcattgtccataccaactgagttaggctc |
32944899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Original strand, 33373751 - 33373819
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||| ||||| |||| ||||| ||||||| |||||||||| |
|
|
| T |
33373751 |
ggggtttgaaccccagaccttacata-tattatgaattgtccataccaactgagttaaggtcacgaggac |
33373819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 464
Target Start/End: Original strand, 39138989 - 39139026
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttt |
464 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39138989 |
tggtggtcggagtttgaaccccgaaccttacatatttt |
39139026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 39433480 - 39433404
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||| ||| ||||||| |||||| |||||||| ||| ||||| |||||||||| || ||||||||||||||| |
|
|
| T |
39433480 |
tggtggccggcgttcgaaccccagaccttgcatatttt-atgtattgttcatatcaactgagctaagctcacgaggac |
39433404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 44293645 - 44293569
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||| ||||| ||||||| || ||||||||| || |||||||||| ||| ||||| || ||||||||||||||| |
|
|
| T |
44293645 |
tggtggtcagggttcgaaccccagatcttacatatatt-atgcattgtctataccaactgagctaagctcacgaggac |
44293569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 12748971 - 12748924
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
12748971 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
12748924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 434 - 474
Target Start/End: Original strand, 13124361 - 13124400
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
13124361 |
cggggtttgaaccccggaccttgcata-ttttatgcattgt |
13124400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 498
Target Start/End: Original strand, 15001266 - 15001337
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||| |||||||||||||| | | ||||| ||||||||||||| |
|
|
| T |
15001266 |
tggtggccggggtttgaaccttggaccttgcata-ttttatgcattgtcgaaaccaactgagttaagctcacg |
15001337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 455
Target Start/End: Original strand, 24023699 - 24023727
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggacctt |
455 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24023699 |
tggtggtcggggtttgaaccccggacctt |
24023727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 32051523 - 32051570
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
32051523 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
32051570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 430 - 474
Target Start/End: Complemental strand, 44087305 - 44087262
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
44087305 |
tggtcgtggtttgaaccccg-accttgcatatttttatgcattgt |
44087262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 6e-20; HSPs: 59)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 24079831 - 24079908
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
24079831 |
tggtggtcggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
24079908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 10261760 - 10261837
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
10261760 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
10261837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 21562695 - 21562618
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
21562695 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
21562618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 26926701 - 26926778
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
26926701 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
26926778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 43330216 - 43330139
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
43330216 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
43330139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 9946497 - 9946421
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
9946497 |
tggtggtcggggtttgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgaggac |
9946421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 14202472 - 14202546
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||| | || ||||||| |||||||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacata-tattatgcattatccaaatcaactgagttaagctcacgaggac |
14202546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 51450282 - 51450205
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||| || |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
51450282 |
tggtggccggggtttgaactccggaccttgcatatctt-atgcattgtcctaccaactaagctaagctcacgaggacga |
51450205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 429 - 504
Target Start/End: Original strand, 43374265 - 43374340
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||| ||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcata-ttttatgcattgtccatatcaactgagctaagctcacgaggacg |
43374340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 427 - 501
Target Start/End: Original strand, 49041972 - 49042046
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgagg |
501 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | |||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
49041972 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtctatatcaactaggctaagctcacgagg |
49042046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 426 - 503
Target Start/End: Original strand, 19479467 - 19479544
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| | |||||||||| |||||| |||| || ||||||||| ||||| |
|
|
| T |
19479467 |
atggtggtcggggtttgaaccccggaccttgcata-tattatgcattgttcatattaactgagctaagctcacaaggac |
19479544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 429 - 510
Target Start/End: Original strand, 35021460 - 35021541
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacgactaag |
510 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||| ||||||| ||||| |||||||||| || ||||||||||||||| |||||| |
|
|
| T |
35021460 |
gtggtcggggttcgaaccccgaaccttgcata-ttttatgtattgtccatatcaactgagctaagctcacgaggacaactaag |
35021541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 35287498 - 35287575
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| |||||||||||| ||||| ||||| || |||||||||||||||| |
|
|
| T |
35287498 |
tggtggccggggttggaaccccggaccttgcata-ttttatgcattgttcataccaactgagctaagctcacgaggacg |
35287575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 11949754 - 11949830
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||||||||| |||| ||||| || |||||||| |||||| |
|
|
| T |
11949754 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgtccataccaactgagctaagctcatgaggac |
11949830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 22164260 - 22164336
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| | |||||||||| || || |||||||| ||| ||||||||||| |
|
|
| T |
22164260 |
tggtggtcggggtttgaaccccagaccttacata-tattatgcattgttcctaccaactaagctaaactcacgaggac |
22164336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 436 - 503
Target Start/End: Complemental strand, 43722826 - 43722759
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||| |||| ||||| |||||| ||||||||||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacata-tattatgcattgtccataccaactgagttaaactcacgaggac |
43722759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 8607197 - 8607119
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
8607197 |
tggtagtcggggtttgaactccggaccttacata-cattatgcattgtccatatcaactgagtcaagcttacgaggacga |
8607119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 19588224 - 19588146
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||| ||||||||||||| |||| ||| | || ||||||||||||||||| |
|
|
| T |
19588224 |
tggtggccggggtttgaaccctggaccttgcata-ttttatgcattgtccataccaattgagctaagctcacgaggacga |
19588146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Original strand, 26871683 - 26871753
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
26871683 |
cggggttcaaaccccggacctgacatatatttgtgcattgttcctatcaactgagttaagctcacgaggac |
26871753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Complemental strand, 32180900 - 32180823
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||||||||||| ||||||| ||| || |||| |||||||||||||| ||| ||||| || |||||||||||||||| |
|
|
| T |
32180900 |
tggtggtcggggttcgaaccccagactttgcata-ttttatgcattgtctataccaactgagctaagctcacgaggacg |
32180823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 435 - 503
Target Start/End: Original strand, 21991246 - 21991314
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||| ||||||||| |||||||| |||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
21991246 |
ggggttcgaactccggaccttgcatatttt-atgcattgtccataccaactaagataagctcacgaggac |
21991314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 24664982 - 24665058
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| | ||||||||| | |||| ||||| || ||||||||||||||| |
|
|
| T |
24664982 |
tggtggtcggggttcgaaccccggaccttgcata-tattatgcattctccataccaactgagctaagctcacgaggac |
24665058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 499
Target Start/End: Complemental strand, 36490638 - 36490566
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
36490638 |
tggtggtcgggatttgaaccccggatcttgcata-cattatgcattgtccataccaactaagttaagctcacga |
36490566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 42845095 - 42845019
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatat-caactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||| | |||||||||||| | | ||||| |||||||||||||||||| |
|
|
| T |
42845095 |
tggtggtcggagttttaaccccggaccttgcata-tattatgcattgtcctttccaactgagttaagctcacgaggac |
42845019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 43034333 - 43034409
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||| | |||||| ||||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
43034333 |
tggtggccggggtttgaacctcagaccttgcatatatt-atgcattgtccataccaactgagttaagctcacgaggac |
43034409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 54857606 - 54857682
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| |||||||||||| | ||| |||| || ||||||||||||||| |
|
|
| T |
54857606 |
tggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtttataccaaccgagctaagctcacgaggac |
54857682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 437 - 500
Target Start/End: Original strand, 6459925 - 6459988
Alignment:
| Q |
437 |
ggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||| |||| ||||||||||||||| || |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
6459925 |
ggttcgaactccggaccttacatatatt-atgcattgtccatatcaactgagttaagctcacgag |
6459988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 39171370 - 39171437
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| | ||||| |||||||| |||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
39171370 |
gggtttgaaccctgaaccttgcatatttt-atgcattgtccatatcaactgagctaagctcacgaggac |
39171437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 502
Target Start/End: Complemental strand, 43499661 - 43499586
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||| |||||| |||| ||| |||| |||||||||||||| |
|
|
| T |
43499661 |
tggtggccggggtttgaaccccggaccttgtata-ttttatacattgtccataccaattaagctaagctcacgagga |
43499586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 474
Target Start/End: Original strand, 17948127 - 17948173
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
17948127 |
tggtggtcggggtttgaactccgaaccttacata-ttttatgcattgt |
17948173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 434 - 500
Target Start/End: Complemental strand, 32139403 - 32139336
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||| ||||| | |||||||| || |||||||||||| |
|
|
| T |
32139403 |
cggggttcgaaccccggaccttgcatatatttatgtattgtccctatcaactgagctaagctcacgag |
32139336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 500
Target Start/End: Original strand, 50380826 - 50380900
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||| | |||||||||| ||||| ||||| | ||||||||||||| |
|
|
| T |
50380826 |
atggtggtcgagatttgaactccggaccttacata-tattatgcattgttcataccaactgaattaagctcacgag |
50380900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 500
Target Start/End: Complemental strand, 53864955 - 53864885
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||| ||| |||||||||| | ||||||||||||||||| ||||||| | ||||| ||||||||||||||| |
|
|
| T |
53864955 |
gtggccggagtttgaacccagaaccttacatatttttatacattgtc-caacaactgagttaagctcacgag |
53864885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 19587903 - 19587833
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||| || |||||||| || ||| |||| |||||| |
|
|
| T |
19587903 |
cggggtttgaaccccggacttgacatatatttatgcattgttcctatcaactgagctaaactcatgaggac |
19587833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Original strand, 21114296 - 21114330
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21114296 |
tggtggtcggggtttgaaccccggaccttgcatat |
21114330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 503
Target Start/End: Original strand, 22630350 - 22630427
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||| | ||||||||||||| || ||||| || ||| ||||||||||| |
|
|
| T |
22630350 |
atggtggtcggggtttgaacctcagaccttgcata-tattatgcattgtcactaccaactgagataatctcacgaggac |
22630427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 499
Target Start/End: Complemental strand, 34033404 - 34033331
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||| |||||||||| | || |||||||| |||||||||||||| |
|
|
| T |
34033404 |
atggtggtcggggttcaaactccggaccttgcata-ttttatgcatggttcttatcaactgagttaagctcacga |
34033331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 430 - 499
Target Start/End: Original strand, 40070962 - 40071031
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||||||| |||||||| |||| | |||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
40070962 |
tggtcggggtttgaacttcggaccttgcata-tattatgcattgttcataccaactgagttaagctcacga |
40071031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 450 - 503
Target Start/End: Original strand, 41144405 - 41144459
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||| |||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
41144405 |
gaccttgcatatatttatgaattgtctatatcaactgagttaagctcacgaggac |
41144459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 432 - 498
Target Start/End: Complemental strand, 42861810 - 42861745
Alignment:
| Q |
432 |
gtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||| |||| |||| ||||||||||||||| || |||||||||| || ||||| ||||||||||||| |
|
|
| T |
42861810 |
gtcgaggttcgaactccggaccttacatatgtt-atgcattgtcctaccaactgagttaagctcacg |
42861745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 438 - 499
Target Start/End: Original strand, 49952571 - 49952632
Alignment:
| Q |
438 |
gtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| || ||||| | |||||||||||||| |
|
|
| T |
49952571 |
gtttgaaccccggaccttacata-tattatgcattgtccaaatcaattgagttaagctcacga |
49952632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 54500639 - 54500566
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| | |||||||||||| || ||||| || |||||||||||| |
|
|
| T |
54500639 |
tggtggtcagtgtttgaaccccggaccttacata-tattatgcattgtctctaccaactgagctaagctcacgag |
54500566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 55962568 - 55962646
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||| | || ||||||| |||||| ||||| |||||||||||| ||||||||| |||||| || ||||||||| |
|
|
| T |
55962568 |
tggtggtcgagattcgaaccccaaaccttatatattattatgcattgtctatatcaactgagttaaacttacgaggacg |
55962646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Complemental strand, 5924719 - 5924647
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||| | ||||| ||||| |||| ||||| || ||||||||||| |
|
|
| T |
5924719 |
tggtggtcgaggtttgaaccccggaccttccata-tattatgtattgtccatagcaactgagctaagctcacga |
5924647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 447 - 503
Target Start/End: Original strand, 7030904 - 7030960
Alignment:
| Q |
447 |
ccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
7030904 |
ccggaccttgcatatttt-atgcattgtctataccaactgagttaagctcacgaggac |
7030960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 7230350 - 7230274
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
7230350 |
tggtggccgaggtttgaaccccggaccttgcata-tattatgcattgtccttaccaactgagctaagctcacgaggac |
7230274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 16470374 - 16470298
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||| ||||||||||||| |||| ||| | || || |||||||||||| |
|
|
| T |
16470374 |
tggtggtcggggttcgaaccctggaccttgcata-ttttatgcattgtccataccaattgagctacgctcacgaggac |
16470298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 21318244 - 21318320
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| | ||||||||||| | || ||||| |||||||||| ||||||| |
|
|
| T |
21318244 |
tggtggtcggggtttgaaccctagaccttgcata-tattatgcattgtccctaccaactgagttaagctcgcgaggac |
21318320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 474 - 503
Target Start/End: Original strand, 24837511 - 24837540
Alignment:
| Q |
474 |
tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24837511 |
tcatatcaactaagttaagctcacgaggac |
24837540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 26331977 - 26331900
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||| |||| |||| ||| | |||||| ||||||||||| |
|
|
| T |
26331977 |
tggtggtcggagtttgaaccttgaaccttacatatttttatgtattgttcatgccaattgagttaaactcacgaggac |
26331900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 30135210 - 30135134
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||| | ||||||||| | | |||||||| |||||||||||| ||||| |
|
|
| T |
30135210 |
tggtggtcggggtttgaacctcggatctgacata-tattatgcattatccttatcaactgagttaagctcacaaggac |
30135134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Complemental strand, 30780191 - 30780123
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| |||| |||||| ||||||| |||||||||| ||| ||||| ||||||||||||| |||| |
|
|
| T |
30780191 |
ggggtttgaatcccgaaccttatatatttt-atgcattgtccataccaactgagttaagctcacgtggac |
30780123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 49491258 - 49491182
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||| || || |||| || | ||||||||||||||||||| |||||| |
|
|
| T |
49491258 |
tggtggtcggagtttgaactccggactttacatatatt-atacattatccttatcaactaagttaagctcaagaggac |
49491182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Original strand, 56361804 - 56361877
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||| ||||||| |||||| |||||| ||||| | ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
56361804 |
tggtggccggggttcgaaccctagaccttgtatattatcatgcattgttcatatcaactgagttaagctcacga |
56361877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 56564974 - 56565050
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||| |||||| |||||| |||||||| |||||||||| ||||||| | || ||||||||||||||| |
|
|
| T |
56564974 |
tggtgttcggggttcgaaccctagaccttgcatatttt-atgcattgtccatatcaattgagctaagctcacgaggac |
56565050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 504
Target Start/End: Complemental strand, 10399321 - 10399245
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||| |||| |||||||||||||| ||||||||| ||||| |||| ||||| ||| | | |||| |||||||||||| |
|
|
| T |
10399321 |
gtggccgggatttgaaccccggactttacatattattatgtattgttcataccaattgaattaaactcacgaggacg |
10399245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 20799394 - 20799461
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
20799394 |
gggtttgaaccccggaccttgcata-tattatgcattgtccctaccaactgagctaagctcacgaggac |
20799461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 435 - 475
Target Start/End: Original strand, 32206679 - 32206719
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
32206679 |
ggggttcgaacccgggaccttacatatatttatgcattgtc |
32206719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 498
Target Start/End: Complemental strand, 38375027 - 38374956
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||| |||||||||||| || |||||| ||||| || |||||||||| || ||||||||||||||||||| |
|
|
| T |
38375027 |
tggtggccggggtttgaactccagaccttgcatatatt-atgcattgtccctaccaactaagttaagctcacg |
38374956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 47)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 51047160 - 51047237
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||| |||| |||||||| |||||||||| |||| |
|
|
| T |
51047160 |
tggtggtcggggtttgaaccccggaccttacatattattatacattgtccataccaactaaggtaagctcacggggac |
51047237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 916509 - 916432
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
916509 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
916432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 7464482 - 7464558
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||| | || ||||| |||||||||||||||||| |
|
|
| T |
7464482 |
tggtggtcggggtttgaaccccggaccttacata-tattatgcattgtccctaccaactgagttaagctcacgaggac |
7464558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 25874201 - 25874127
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
25874201 |
tggtggtcgatggttgaaccccggaccttacatattattatgcattgtccataccaactgagttaagctcacgag |
25874127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 427 - 497
Target Start/End: Original strand, 48849754 - 48849823
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcac |
497 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
48849754 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtcataccaactgagttaagctcac |
48849823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 442 - 503
Target Start/End: Original strand, 8747242 - 8747302
Alignment:
| Q |
442 |
gaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8747242 |
gaaccccggaccttacatatatt-atgcattgtcataccaactaagttaagctcacaaggac |
8747302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 28244095 - 28244171
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||| |||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
28244095 |
tggtgatcggggttcgaaccccggaccttgcata-ttttatgcattgttcataccaactgagttaagctcacgaggac |
28244171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 427 - 502
Target Start/End: Original strand, 25340915 - 25340990
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| ||||||||||||| |||| ||||| || |||||||||||||| |
|
|
| T |
25340915 |
tggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgagga |
25340990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 427 - 506
Target Start/End: Original strand, 38130950 - 38131029
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacgac |
506 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||||||| |||| ||||| |||||||||||| |||||||| |
|
|
| T |
38130950 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtccataccaactgagttaagctcacaaggacgac |
38131029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 44075147 - 44075224
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||| |||||||||||||| || ||||||| ||| ||||||||||||| |
|
|
| T |
44075147 |
tggtggccggggtttgaactccggaccttgcata-ttttatgcattgtcctacaaactaagctaaactcacgaggacga |
44075224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 22722472 - 22722396
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||||||| ||||| |||| || ||||||||||||||| |
|
|
| T |
22722472 |
tggtggtcggggtttgaacctcggaccttgcata-ttttatgcattgttcatactaactgagctaagctcacgaggac |
22722396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 428 - 503
Target Start/End: Original strand, 5293636 - 5293712
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| | ||||||| |||||||| |||||| |||||||||||| ||| ||||||||||||| | |||||||| |
|
|
| T |
5293636 |
ggtggtcggaggttgaaccacggaccttgcatattattatgcattgtcaataccaactaagttaagtttacgaggac |
5293712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 334838 - 334915
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgca-ttgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| ||||||||| |||| |||| ||||| |||||| ||||||||||| |
|
|
| T |
334838 |
tggtggccggggtttgaaccccggaccttgcata-ttttatgcatttgtccataccaactgagttaaactcacgaggac |
334915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 7738732 - 7738663
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||| | || ||||| |||||||||||||||||| |
|
|
| T |
7738732 |
cggggcttgaaccccggaccttgcata-ttttatgcattgtccctaccaactgagttaagctcacgaggac |
7738663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 429 - 475
Target Start/End: Original strand, 34442440 - 34442485
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacata-ttttatgcattgtc |
34442485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 44579699 - 44579630
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
44579699 |
cggggttcgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgaggac |
44579630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 44799046 - 44799123
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||| ||||||||||||||| |||| || |||||||| ||| ||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
44799046 |
tggtgatcggggtttgaaccctggactttgcatatttt-atgtattgttcttatcaaataagttaagctcacgaggacg |
44799123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 1707739 - 1707815
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcatt-gtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||| |||| ||||| ||||| |||||||||||| ||||| |
|
|
| T |
1707739 |
tggtggtcggggtttgaacgccgcaccttacata-ttttatacattattcataccaactgagttaagctcacaaggac |
1707815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 7827578 - 7827502
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| || |||| || |||||||||||| || |||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
7827578 |
tggtggtcgggtttcgaactccagaccttacatatatt-atgcattgtccatatcaactgagttaaactcacgaggac |
7827502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 32843253 - 32843329
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||| ||||||||||||| || | ||||| || ||||||||||||||| |
|
|
| T |
32843253 |
tggtggccggggtttgaaccccagaccttgcata-ttttatgcattgtccaaaccaactgagctaagctcacgaggac |
32843329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 44582795 - 44582718
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||||| |||||||||| |||| ||||| || | ||||||||||||| |
|
|
| T |
44582795 |
tggtggccggggttcgaaccccggaccttgcatattattatgcattgcccataccaactgagctgagctcacgaggac |
44582718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 34899167 - 34899120
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
34899167 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgtc |
34899120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 503
Target Start/End: Complemental strand, 39481206 - 39481135
Alignment:
| Q |
432 |
gtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
39481206 |
gtcggggtttgaaccccgaatcttacata-atttatgcattgtccataccaactgagctaagctcacgaggac |
39481135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 430 - 500
Target Start/End: Original strand, 2186421 - 2186491
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | ||||| ||||| |||| ||||| ||||||| ||||||| |
|
|
| T |
2186421 |
tggtcggggtttgaaccccagaccttacata-tattatgtattgtccataccaactgagttaagttcacgag |
2186491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Complemental strand, 23332717 - 23332644
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||| || ||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
23332717 |
gtggtcggggtttgaacca-gaaccatacatatatt-atgcattgttcatatcaactaagttaagttcacgaggac |
23332644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 26768471 - 26768393
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||||||||||||||| | | |||||| |||| |||||||||||||| ||| || || || ||||||||||||||||| |
|
|
| T |
26768471 |
tggtggtcggggtttgaagctcagaccttgcata-ttttatgcattgtctataccagctgagataagctcacgaggacga |
26768393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 12699996 - 12700069
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||||||| |||||||||||||| || ||| |||||||| |||||||| |
|
|
| T |
12699996 |
tggtggccggagtttgaaccccggactttacata-ttttatgcattgtctatgccaattaagttaaactcacgag |
12700069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 465 - 503
Target Start/End: Complemental strand, 21594736 - 21594698
Alignment:
| Q |
465 |
tatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21594736 |
tatgcattgtcctagcaactaagttaagctcacgaggac |
21594698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 32909292 - 32909365
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| |||| ||||||||| ||||||| |||||||| |||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
32909292 |
tggtggccgggatttgaacccaggaccttgcatatttt-atgcattgtccatactaactgagttaagctcacgag |
32909365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 431 - 508
Target Start/End: Complemental strand, 39552530 - 39552453
Alignment:
| Q |
431 |
ggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacgacta |
508 |
Q |
| |
|
|||||||||| || |||| ||||| |||||||| ||||||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
39552530 |
ggtcggggttcaaatcccgaaccttgcatatttt-atgcattgtttataccaactaagttaagctcatgaggacgacta |
39552453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 450 - 503
Target Start/End: Original strand, 46088813 - 46088867
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||| ||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
46088813 |
gaccttgcatatatttatgcattgtctatatcaactgagtcaagctcacgaggac |
46088867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 438 - 503
Target Start/End: Complemental strand, 46903967 - 46903902
Alignment:
| Q |
438 |
gtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||| |||| ||||| |||||| ||||||||||| |
|
|
| T |
46903967 |
gtttgaaccctggaccttacata-tattatgcattgtccataccaactgagttaatctcacgaggac |
46903902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 53706886 - 53706818
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||| | | ||| |||||||||||||||||||| |
|
|
| T |
53706886 |
cggggtttgaaccc-ggaccttacatattta-atgcattgtccttaccaattaagttaagctcacgaggac |
53706818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 8127533 - 8127457
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||| |||||||||| | | ||||| |||||||||||||||||| |
|
|
| T |
8127533 |
tggtggtcatggtttgaaccccaaaccttgcatatttt-atgcattgtccttaccaactgagttaagctcacgaggac |
8127457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 499
Target Start/End: Complemental strand, 21160114 - 21160050
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||| | |||||||||| ||||||| |||||| |
|
|
| T |
21160114 |
ggggtttgaacccccgaccttacata-tattatgcattatccatatcaactgagttaagttcacga |
21160050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 498
Target Start/End: Complemental strand, 21245860 - 21245792
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| | ||||||||||| | || |||||||| |||||||||| |
|
|
| T |
21245860 |
tggtcgaggtttgaaccccagaccttacata-tattatgcattgtccttaccaactaagctaagctcacg |
21245792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 32629150 - 32629074
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| ||| |||||||||||||| |||| ||||||||||||| |||| ||||| || |||||||||| |||| |
|
|
| T |
32629150 |
tggtggtcgatgttcgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgtggac |
32629074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Complemental strand, 33745161 - 33745093
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||||||||| |||||||| | || |||||||||| |||| |
|
|
| T |
33745161 |
ggggtttgaaccccagaccttgcata-ttttatgcattgtccatatcaattgagctaagctcacggggac |
33745093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 51882191 - 51882267
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||| ||| ||| |||| | ||||||||||| |||| ||||| ||||||||||||| |||| |
|
|
| T |
51882191 |
tggtggccggggtttgaaccctggatcttgcata-tattatgcattgtccataccaactgagttaagctcacggggac |
51882267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 464
Target Start/End: Complemental strand, 52456551 - 52456514
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttt |
464 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
52456551 |
tggtggtcagggttcgaaccccggaccttacatatttt |
52456514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 499
Target Start/End: Complemental strand, 54113403 - 54113338
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||| |||||| ||||||| |||| ||||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
54113403 |
ggggttcgaacccgggaccttgcatacatttatgcattgtctatatcaactgagctaagctcacga |
54113338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 4601914 - 4601867
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| || |||||||||||| |
|
|
| T |
4601914 |
tggtggccggggtttgaaccccggaccttgcat-ttattatgcattgtc |
4601867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 498
Target Start/End: Complemental strand, 7651256 - 7651185
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||| | |||||||||| | |||||||| ||||||||||||| |
|
|
| T |
7651256 |
tggtggtcggcgtttgaaccccgaaccttatata-tactatgcattgtccctatcaactgagttaagctcacg |
7651185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 436 - 503
Target Start/End: Complemental strand, 10617615 - 10617547
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| ||||||| |||||| |||| |||||||||| || ||||||||| || ||||||||||||||| |
|
|
| T |
10617615 |
gggttcgaaccccagaccttgtatatatttatgcattatccatatcaactgagctaagctcacgaggac |
10617547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 498
Target Start/End: Original strand, 10922299 - 10922370
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||| | ||||||||||| | || ||||| ||||||||||||| |
|
|
| T |
10922299 |
tggtagtcggggtttgaaccccggatcttgcata-tattatgcattgtccctaccaactgagttaagctcacg |
10922370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 25727958 - 25728005
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
25727958 |
tggtggtcgggatttgaaccccggaccttgcata-tattatgcattgtc |
25728005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 43316600 - 43316668
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||| |||||| ||||| |||||||||| || ||||||||| || ||||||||||||||| |
|
|
| T |
43316600 |
gggttcgaacccgcgaccttgcatatatttatgcattatctatatcaactgagctaagctcacgaggac |
43316668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 4e-18; HSPs: 29)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 434 - 505
Target Start/End: Complemental strand, 33976307 - 33976237
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
33976307 |
cggggtttgaaccccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
33976237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 247729 - 247652
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
247729 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
247652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 430 - 503
Target Start/End: Complemental strand, 13496183 - 13496110
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| || ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
13496183 |
tggtcggggtttgaactccggaccttgcatatatt-atgcattgttcatatcaactgagttaagctcacgaggac |
13496110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 12582220 - 12582297
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| || |||||| |||||||| |||||||||| || |||||||| ||||||||| ||||||| |
|
|
| T |
12582220 |
tggtggccggggtttgaactccagaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacaaggacga |
12582297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 14296948 - 14297024
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||| ||||| |||| ||||| || ||||||||| ||||| |
|
|
| T |
14296948 |
tggtggccggggtttgaaccccggaccttacata-ttttatgtattgtccataccaactcagctaagctcacaaggac |
14297024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 430 - 502
Target Start/End: Original strand, 1989037 - 1989108
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||| |||||||||| | ||||||||||| || ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
1989037 |
tggtcgaggtttgaacctcaaaccttacatatatt-atgcattgtcataccaactgagttaagctcacgagga |
1989108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 497
Target Start/End: Original strand, 24623308 - 24623378
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcac |
497 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
24623308 |
tggtggtcggggtttgaaccccgaaccttacata-tattatgcattgtccatatcaactgagctaaactcac |
24623378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Complemental strand, 8917670 - 8917592
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| || ||| ||||| | || |||| ||||||||||||||||||| |
|
|
| T |
8917670 |
tggtggccggggtttgaaccccagaccttacatatattaatgtattgtccttactaactgagttaagctcacgaggacg |
8917592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 442 - 503
Target Start/End: Original strand, 12841883 - 12841945
Alignment:
| Q |
442 |
gaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
12841883 |
gaaccccggaccttacatatatttatgcattgtcgctatcaaccgagctaagctcacgaggac |
12841945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 450 - 503
Target Start/End: Original strand, 16890462 - 16890515
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
16890462 |
gaccttacatatttt-atgcattgtccataccaactaagttaagctcacgaggac |
16890515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 429 - 502
Target Start/End: Complemental strand, 20744206 - 20744133
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| | ||||||||||| |||| ||||| || |||||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcata-tattatgcattgtccataccaactgagctaagctcacgagga |
20744133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 34828378 - 34828300
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||| ||||| | ||||||||||||| ||||||||||| |||| ||||| || ||| ||||||||||| |
|
|
| T |
34828378 |
atggtggccggggttcgaacctcagaccttacatattattatgcattgtccataccaactgagctaaactcacgaggac |
34828300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 16390499 - 16390423
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacata-tattatgcattgtccctaccaactgaggtaagctcacgaggac |
16390423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 429 - 461
Target Start/End: Original strand, 22792933 - 22792965
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22792933 |
gtggtcggggtttgaaccccggaccttacatat |
22792965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 23903298 - 23903373
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| |||||||||||| || || ||||| || |||||||||| || ||||| || ||||||||||||||| |
|
|
| T |
23903298 |
tggtggtcggtgtttgaaccccgaacgttgcatatatt-atgcattgtcttaccaactcagctaagctcacgaggac |
23903373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 428 - 503
Target Start/End: Complemental strand, 28898925 - 28898850
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||| | ||||||||||| | || ||||||||||||| |||||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcata-tattatgcattgtccttaccaactaagttaagatcacgaggac |
28898850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 499
Target Start/End: Original strand, 2655020 - 2655090
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatc-aactaagttaagctcacga |
499 |
Q |
| |
|
|||| |||||||||||||||||| |||||||| |||||||||||||| | | |||| |||||||||||||| |
|
|
| T |
2655020 |
gtggccggggtttgaaccccggatcttacata-ttttatgcattgtcccaacaaactgagttaagctcacga |
2655090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 474
Target Start/End: Complemental strand, 15170001 - 15169955
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
15170001 |
tggtggtcggggtttgaaccccgaaccttacata-tattatgcattgt |
15169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 474
Target Start/End: Complemental strand, 15178773 - 15178727
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
15178773 |
tggtggtcggggtttgaaccccgaaccttacata-tattatgcattgt |
15178727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 475
Target Start/End: Complemental strand, 21184744 - 21184705
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
21184744 |
gggtttgaactccgaaccttacatatttttatgcattgtc |
21184705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Complemental strand, 32621442 - 32621408
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
32621442 |
tggtggtcggggtttgaatcccggaccttacatat |
32621408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 788936 - 788860
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
788936 |
tggtggtcggggtttgaactccgaaccttgcata-tattatgcattgtccttaccaactgagataagctcacgaggac |
788860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 2445369 - 2445293
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||||| | ||| |||| || ||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
2445369 |
tggtggtcggggttcgaaccccgaatcttgtatatatt-atgcattgttcatatcaactgagttaagcttacgaggac |
2445293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 8569779 - 8569703
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||||||| |||| ||| | |||||| |||||| |||| |
|
|
| T |
8569779 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtccataccaattgagttaaactcacggggac |
8569703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Original strand, 8629687 - 8629759
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||| ||||||||||||| ||||| |||| | ||||||||||| |||| ||| | |||||||||||||| |
|
|
| T |
8629687 |
tggtggtcgaggtttgaaccccgaaccttgcata-tattatgcattgtccataccaattgagttaagctcacga |
8629759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 29740552 - 29740476
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| | || | ||||||||||| |||| ||| | || ||||||||||||||| |
|
|
| T |
29740552 |
tggtggccggggtttgaaccccggaccttgcgta-tattatgcattgtccataccaattgagctaagctcacgaggac |
29740476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 502
Target Start/End: Complemental strand, 5267094 - 5267018
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| || ||||||| | | |||||||| |||||| ||||| |||| |
|
|
| T |
5267094 |
tggtggtcggggtttgaattccggaccttgcatatattaatgcattatccttatcaactgagttaatctcactagga |
5267018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 9367471 - 9367424
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||| |||||||||||||| |
|
|
| T |
9367471 |
tggtggtcggggtttgaatcccagaccttgcata-ttttatgcattgtc |
9367424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 461
Target Start/End: Original strand, 34481407 - 34481439
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
34481407 |
gtggtcggggtttgaaccccggaccttgcatat |
34481439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 61)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 20763224 - 20763147
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
20763224 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
20763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 29488790 - 29488713
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
29488790 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
29488713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 33232388 - 33232465
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
33232388 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
33232465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 34284530 - 34284607
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
34284530 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
34284607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 426 - 505
Target Start/End: Original strand, 19036092 - 19036170
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||| |||||||||||| || |||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
19036092 |
atggtggccggggtttgaactccagaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
19036170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 426 - 505
Target Start/End: Complemental strand, 20718544 - 20718466
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||| |||||||||||| || |||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
20718544 |
atggtggccggggtttgaactccagaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
20718466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 427 - 484
Target Start/End: Original strand, 18773747 - 18773804
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaact |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
18773747 |
tggtggtcggggtttgaaccccggaccttacata-ttttatgcattgtccatatcaact |
18773804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 19416584 - 19416508
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| ||||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
19416584 |
tggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgaggac |
19416508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 439 - 503
Target Start/End: Original strand, 38025121 - 38025186
Alignment:
| Q |
439 |
tttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | |||| ||||| |||||||||||||||||| |
|
|
| T |
38025121 |
tttgaaccccggaccttacatatttttattcattatccataccaactgagttaagctcacgaggac |
38025186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 430 - 503
Target Start/End: Original strand, 23198743 - 23198816
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||| || |||| |||||||||||| ||||| ||||| |||||| ||||||||||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcata-ttttatgcattgttcataccaactgagttaaactcacgaggac |
23198816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 10026064 - 10025988
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||||| || | ||||| |||||||||||||||||| |
|
|
| T |
10026064 |
tggtggtcggggtttgaaccccataccttgcata-ttttatgcattgtccaaaccaactgagttaagctcacgaggac |
10025988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 430 - 503
Target Start/End: Complemental strand, 36755081 - 36755009
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||| || |||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
36755081 |
tggtcggagtttgaatcccgaaccttacatatatt-atgcattgtcctaccaactgagttaagctcacgaggac |
36755009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 430 - 503
Target Start/End: Complemental strand, 36760878 - 36760806
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||| || |||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
36760878 |
tggtcggagtttgaatcccgaaccttacatatatt-atgcattgtcctaccaactgagttaagctcacgaggac |
36760806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 428 - 503
Target Start/End: Complemental strand, 19599214 - 19599139
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | ||||||||||| |||| ||||| |||||| ||||| ||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcata-tattatgcattgtccataccaactgagttaaactcaccaggac |
19599139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 27833392 - 27833439
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
27833392 |
tggtggtcggggtttgaaccccggaccttacata-tattatgcattgtc |
27833439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 500
Target Start/End: Original strand, 33671556 - 33671627
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||| | | ||||| ||||||||||||||| |
|
|
| T |
33671556 |
gtggtcggggtttgaacctcgaaccttgcatatttttatgcattattcaaccaactgagttaagctcacgag |
33671627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 34448603 - 34448677
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| | ||||||||||| || | ||||| |||||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacata-tattatgcattgtccaaaccaactgagttaagctcacgaggac |
34448677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 497
Target Start/End: Original strand, 34722011 - 34722082
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcac |
497 |
Q |
| |
|
|||||| | ||||| ||||| ||||||||||||||| |||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
34722011 |
tggtggcctgggttcgaacctcggaccttacatattattatgcattgttcataccaactgagttaagctcac |
34722082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 4905347 - 4905270
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| ||| ||||| |||| ||||||||||||| || | ||||| |||||||||||||||||| |
|
|
| T |
4905347 |
atggtggccggggtttgaactccgaaccttgcata-ttttatgcattgtccacaacaactgagttaagctcacgaggac |
4905270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 20243319 - 20243249
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
20243319 |
cggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggac |
20243249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 442 - 503
Target Start/End: Complemental strand, 24839543 - 24839482
Alignment:
| Q |
442 |
gaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
24839543 |
gaaccccagaccttacatatttt-atgcattgtctataccaactgagttaagctcacgaggac |
24839482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 430 - 503
Target Start/End: Complemental strand, 29726867 - 29726794
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| | |||| ||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcata-tattatacattgttcatgtcaactgagttaagctcacgaggac |
29726794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Complemental strand, 30781522 - 30781445
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||||||||||| |||||| | ||||| ||||||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
30781522 |
tggtggtcggggttcgaaccctgtaccttgt-tatttttatgcattgtctatatcaactgagctaagctcacgaggacg |
30781445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 36341056 - 36341133
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||| ||||||||| |||| ||||| ||||||||||| ||||||| |
|
|
| T |
36341056 |
tggtggtcgaggtttgaactccggaccttgtatatttt-atgcattgttcataccaactgagttaagctcaagaggacg |
36341133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Original strand, 38435923 - 38435993
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
38435923 |
cggggttcaaaccccggacctgacatatatttgtgcattgttcctatcaactgagttaagctcacgaggac |
38435993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 42995340 - 42995270
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
42995340 |
cggggttcaaaccccggacctgacatatatttgtgcattgttcctatcaactgagttaagctcacgaggac |
42995270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 6023379 - 6023303
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||| ||||||| || | ||||| || ||||||||||||||| |
|
|
| T |
6023379 |
tggtggtcggggtttgaaccccgaaccttgcata-ttttaagcattgtccaaaccaactgagctaagctcacgaggac |
6023303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 7388030 - 7388106
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| | ||||||||||| | | ||||| |||||||||||||||||| |
|
|
| T |
7388030 |
tggtggtcggggtttgaatcccgaaccttacata-tattatgcattgtcccaaccaactgagttaagctcacgaggac |
7388106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 8290460 - 8290536
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| || |||||||||||||| |||||| ||||||||||| |||| ||||| || | ||||||||||||| |
|
|
| T |
8290460 |
tggtggtcgggattcgaaccccggaccttgcatattattatgcattgtccataccaact-agctgagctcacgaggac |
8290536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 426 - 503
Target Start/End: Original strand, 20085749 - 20085825
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||| | |||||||||||| || | ||| |||||| ||||||||||| |
|
|
| T |
20085749 |
atggtgtttggggtttgaaccccggaccttgcata-tattatgcattgtcttaccgactgagttaaactcacgaggac |
20085825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 27462427 - 27462503
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||||||| |||| ||||| || || |||||||||||| |
|
|
| T |
27462427 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtccataccaactgagctatgctcacgaggac |
27462503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 436 - 499
Target Start/End: Original strand, 46220951 - 46221013
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
46220951 |
gggtttgaacccccgaccttacata--tttatgcattgtccataccaactgagttaagctcacga |
46221013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 503
Target Start/End: Complemental strand, 10244788 - 10244721
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcata-tattatgcattgtccataccaactgagctaagctcacgaggac |
10244721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 503
Target Start/End: Original strand, 27993025 - 27993096
Alignment:
| Q |
432 |
gtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||| ||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
27993025 |
gtcgaggtttgaaccctagaccttgcatatttt-atgcattgttcataccaactgagttaagctcacgaggac |
27993096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 40808159 - 40808226
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||| || | ||||| |||||||||||||||||| |
|
|
| T |
40808159 |
gggtttgaaccccggaccttgcata-ttttatgcactgtccaaaccaactgagttaagctcacgaggac |
40808226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 43539104 - 43539171
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| || |||||||| || ||||||||| ||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacata-tattatgcattgttcctatcaactgagctaagctcacaaggac |
43539171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 502
Target Start/End: Original strand, 19050419 - 19050486
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||||||||| |||||||| | |||||||||||||| |
|
|
| T |
19050419 |
gggtttgaaccccggactttgcatatatttatgcattgtctctatcaactgggctaagctcacgagga |
19050486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 19626518 - 19626592
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| ||| |||||||||||||||||| |||| | ||||||||||| || | ||||| |||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcata-tattatgcattgtccaaaccaactgagttaagctcacgaggac |
19626592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Complemental strand, 46552063 - 46551989
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||| || |||||| |||| | | |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
46552063 |
gtggtcggggtttgaactcctgacctttcata-tatcatgcattgtctataccaactgagttaagctcacgaggac |
46551989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Complemental strand, 145588 - 145554
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
145588 |
tggtggtcggggtttgaaccccggaccttgcatat |
145554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 438 - 503
Target Start/End: Complemental strand, 5041398 - 5041333
Alignment:
| Q |
438 |
gtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| |||||| ||||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatatt-atgcattgtccataccaactcagttaagctcacgaggac |
5041333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 5526796 - 5526719
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||| | ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
5526796 |
atggtggtcggggtttgaaccccaaatcttatata-tattatgcattgtccataccaactgagctaagctcacgaggac |
5526719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Original strand, 7994875 - 7994909
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
7994875 |
tggtggtcggggtttgaaccccagaccttacatat |
7994909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 19793876 - 19793798
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| || |||| |||||||| | ||| |||||| | |||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
19793876 |
atggtggccgaggttcgaaccccgaatcttgcatattatcatgcattgtccatatcaactgagttaaactcacgaggac |
19793798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Original strand, 20135159 - 20135229
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||| ||||||| ||||| ||||| ||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
20135159 |
cggggttcgaacccgggaccttgcatatatttatacattgtctttatcaactgagctaagctcacgaggac |
20135229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 21993244 - 21993176
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| ||||| |||| |||||||| |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
21993244 |
cggggtttgaaacccgg-ccttgcatatttt-atgcattgtccataccaactgagttaagctcacgaggac |
21993176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 26980927 - 26981000
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||| | ||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
26980927 |
tggtggccgggctttaaaccccggaccttacata-taatatacattgttcatatcaactgagttaagctcacgag |
26981000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 580917 - 580993
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||| ||||| ||| |||| ||||||||||||| |||| |||| || ||||||||||||||| |
|
|
| T |
580917 |
tggtggtcggggttcgaacgccggatcttgcata-ttttatgcattgtccataccaaccgagctaagctcacgaggac |
580993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 3584274 - 3584198
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| | || ||||| ||||| || |||||||||| | | |||||||||||||||| ||||||| |
|
|
| T |
3584274 |
tggtggtcggggtttgaatctcgtaccttgcatatatt-atgcattgtccttaccaactaagttaagctcgcgaggac |
3584198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 475
Target Start/End: Complemental strand, 7908660 - 7908616
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
7908660 |
tggtcggggttcgaaccccgaaccttacata-ttttatgcattgtc |
7908616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Original strand, 37495909 - 37495981
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||| || ||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
37495909 |
tggtggtcgggatttgaaccttggaccttgcatatatt-atgcattatcaatatcaattaagttaagctcacga |
37495981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 451 - 503
Target Start/End: Complemental strand, 38728255 - 38728202
Alignment:
| Q |
451 |
accttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
38728255 |
accttgcatatttttatgcattgtccataccaactgagctaagctcacgaggac |
38728202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 40187627 - 40187703
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||| | ||||||||||| | || ||||| ||||||||||| |||||| |
|
|
| T |
40187627 |
tggtgttcggggtttgaaccgcagaccttacata-tattatgcattgtccctaccaactgagttaagctcatgaggac |
40187703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 42829225 - 42829301
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||| |||||||||||||| ||| |||| | ||||||||||| | |||||||| ||| |||||||||||||| |
|
|
| T |
42829225 |
tggtggccggagtttgaaccccggagcttgcata-tattatgcattgtccctatcaactgagtcaagctcacgaggac |
42829301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 434 - 494
Target Start/End: Original strand, 44651963 - 44652024
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagct |
494 |
Q |
| |
|
||||||| |||||| |||||| ||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
44651963 |
cggggttcgaacccgcgaccttgcatatatttatgcattgtttatatcaactaagttaagct |
44652024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 475
Target Start/End: Original strand, 48629055 - 48629103
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| | |||||||||||| |
|
|
| T |
48629055 |
atggtggtcggggtttaaaccccggaccttgcata-tattatgcattgtc |
48629103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 8084497 - 8084450
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
8084497 |
tggtggccggggttcgaaccccggaccttgcata-ttttatgcattgtc |
8084450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 428 - 503
Target Start/End: Original strand, 24225973 - 24226048
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||| ||||||||||||| |||| |||| || |||| |||||||||| |
|
|
| T |
24225973 |
ggtggtcgaggttcgaacctcggaccttacata-ttttatgcattgtccatacgaactgagctaagttcacgaggac |
24226048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 30397139 - 30397092
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| |||||||||||||| |
|
|
| T |
30397139 |
tggtggtcggggttcaaaccccgaaccttacata-ttttatgcattgtc |
30397092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 504
Target Start/End: Complemental strand, 43139333 - 43139258
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| |||||||||| ||| ||||| | || |||||||||||||||| |
|
|
| T |
43139333 |
gtggtcggggtttgaaccccgtaccttgcata-ttttatgcatagtctcaatcaagtgagctaagctcacgaggacg |
43139258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 44434099 - 44434051
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||| |||||||| ||||| || ||||| ||||||||||||| |
|
|
| T |
44434099 |
tggtggtcgggatttgaacctcggactttgcatatatttatgcattgtc |
44434051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 53)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 37462181 - 37462104
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
37462181 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
37462104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 426 - 503
Target Start/End: Original strand, 11637562 - 11637639
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||| ||||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
11637562 |
atggtggtcggggttcgaaccccgaaccttgcata-ttttatgcattgtccataccaactgagttaagctcacgaggac |
11637639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 29695085 - 29695009
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| | ||||||||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
29695085 |
tggtggtcggggtttgaaccacgaaccttacata-tattatgcattgtccatatcaactgagttaaggtcacgaggac |
29695009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 13864414 - 13864341
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||| |||| ||||| ||||| ||||||||||||||| |
|
|
| T |
13864414 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgtattgttcataccaactgagttaagctcacgag |
13864341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 22555301 - 22555225
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||| |||||||||| |||| || |||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
22555301 |
tggtggtcggggtttgattcccggaccttgcata-ttatatgcattgtccataccaactgagttaagctcacgaggac |
22555225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 32559374 - 32559298
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||| |||||||||| ||||||||||| |||||||||||||| ||||||| | || ||||||||||||||| |
|
|
| T |
32559374 |
tggtggccgggatttgaaccccagaccttacata-ttttatgcattgtcaatatcaattgagctaagctcacgaggac |
32559298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 40715940 - 40716016
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||||||| |||||||| | || ||||||||||||||| |
|
|
| T |
40715940 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtccatatcaattgagctaagctcacgaggac |
40716016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 8882399 - 8882466
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| ||||| |||||||| ||||||||||||| |||| |
|
|
| T |
8882399 |
gggtttgaaccccggaccttacata-tattatgcactgtcattatcaactgagttaagctcacggggac |
8882466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 437 - 503
Target Start/End: Complemental strand, 9699989 - 9699922
Alignment:
| Q |
437 |
ggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| ||||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
9699989 |
ggttcgaaccccggacctgacatatatttttgcattgttcctatcaactgagttaagctcacgaggac |
9699922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 31561337 - 31561411
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||||| ||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
31561337 |
gtggtcggggttcaaaccc-ggaccttgcatattattatgcattgtccataccaactgagttaagctcacgaggac |
31561411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 501
Target Start/End: Complemental strand, 39980578 - 39980504
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagg |
501 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| ||||||||||| | |||| ||||| || ||||||||||||| |
|
|
| T |
39980578 |
tggtggtcggggtttgaactccggaccttgcata-ttttatgcattatccataccaactgagctaagctcacgagg |
39980504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 40837896 - 40837970
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |||| ||||| ||||||| |||||||||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcata-ttttatatattgtccataccaactgagttaagttcacgaggac |
40837970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 4009937 - 4009860
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||| || ||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
4009937 |
tggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttaccaactgagctaagctcacgaggac |
4009860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 22522792 - 22522868
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||||||| |||| |||| || ||||||||||||||| |
|
|
| T |
22522792 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtccataccaaccgagctaagctcacgaggac |
22522868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 32200438 - 32200514
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| | ||||||||||| | | |||||| || ||||||||||||||| |
|
|
| T |
32200438 |
tggtggtcggggcttgaaccccggaccttgcata-tattatgcattgtccctgtcaactgagctaagctcacgaggac |
32200514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 426 - 501
Target Start/End: Original strand, 5107235 - 5107310
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcatt-gtcatatcaactaagttaagctcacgagg |
501 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||| | ||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
5107235 |
atggtggtcggggttcgaacctcggaccttgcata-tattatgcattattcataccaactgagttaagctcacgagg |
5107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 5150073 - 5150121
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
5150073 |
tggttgtcggggttcgaaccccagaccttacatattattatgcattgtc |
5150121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 503
Target Start/End: Original strand, 18589867 - 18589934
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||| ||||| || ||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
18589867 |
gggtttaaaccccggaccttgcatatatt-atgcattgttcataccaactgagttaagctcacgaggac |
18589934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 435 - 475
Target Start/End: Original strand, 24636646 - 24636686
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
24636646 |
ggggtttgaacctcggaccttgcatatttttatgcattgtc |
24636686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 498
Target Start/End: Complemental strand, 26409323 - 26409252
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| | ||||||||||| |||| ||||| || |||||||||| |
|
|
| T |
26409323 |
tggtgggcggggttcgaaccccggaccttacata-tattatgcattgtccataccaactgagctaagctcacg |
26409252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 430 - 507
Target Start/End: Original strand, 7336305 - 7336386
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttt---tatgcattgt-catatcaactaagttaagctcacgaggacgact |
507 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||| || |||||||||| | |||||||| || ||||||||||||||||||| |
|
|
| T |
7336305 |
tggttggggtttaaactccggaccttacatatattatttatgcattgttcctatcaactgagctaagctcacgaggacgact |
7336386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 433 - 503
Target Start/End: Complemental strand, 8543640 - 8543570
Alignment:
| Q |
433 |
tcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||| |||||||| |||||||| |||||||||| | | ||||| |||||||||||||||||| |
|
|
| T |
8543640 |
tcggggtttgaactacggacctttcatatttt-atgcattgtccaaaccaactgagttaagctcacgaggac |
8543570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 15889481 - 15889403
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| | ||||||||||| | || ||||| || ||||||||||||||||| |
|
|
| T |
15889481 |
tggtggtcggggtttgaaccctagaccttgcata-tattatgcattgtccctaccaactgagctaagctcacgaggacga |
15889403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Complemental strand, 34191501 - 34191427
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| |||||||||||||||||||||| |||| ||||||||||||| | | ||||| || ||||||||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcata-ttttatgcattgtcccaaccaactgagctaagctcacgaggac |
34191427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 434 - 473
Target Start/End: Original strand, 42708312 - 42708351
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattg |
473 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
42708312 |
cggggtttgaaacccggaccttgcatatttttatgcattg |
42708351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 8544980 - 8545053
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||||||| ||| |||| ||||||||| ||||| || |||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
8544980 |
tggtggtcggagttcgaactccggaccttgcatatatt-atgcattgtccttatcaactgagttaagctcacgag |
8545053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 438 - 503
Target Start/End: Original strand, 10704333 - 10704398
Alignment:
| Q |
438 |
gtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |||| ||||| || ||||||||| ||||| |
|
|
| T |
10704333 |
gtttgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacaaggac |
10704398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 13796400 - 13796327
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||||||| ||||| ||||| |||||| ||||| || ||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
13796400 |
tggtggtcggagtttgtaccccagaccttgcatatatt-atgcattgttcatatcgactgagttaagctcacgag |
13796327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 435 - 504
Target Start/End: Original strand, 21212052 - 21212122
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||| ||||| ||||||| ||||| ||||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
21212052 |
ggggttcgaaccttggaccttgcatataattatgtattgtccatatcaactaagttaagctcacgaagacg |
21212122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 450 - 503
Target Start/End: Complemental strand, 24498631 - 24498578
Alignment:
| Q |
450 |
gaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
24498631 |
gaccttacatatttt-atgcattattcatatcaactgagttaagctcacgaggac |
24498578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 503
Target Start/End: Complemental strand, 26166807 - 26166734
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||| ||| |||||||||| | ||||| || ||||||||||||||| |
|
|
| T |
26166807 |
gtggtcagggtttgaaccctggaccttgcata-tttgatgcattgtccgaccaactgagctaagctcacgaggac |
26166734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 430 - 499
Target Start/End: Original strand, 40155185 - 40155255
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||| ||| ||||||| ||| ||||||||||||| |||||| |||| ||||| || ||||||||||| |
|
|
| T |
40155185 |
tggtcgggatttaaaccccgaaccatacatatttttatacattgtccataccaactgagataagctcacga |
40155255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 499
Target Start/End: Complemental strand, 5614827 - 5614763
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||| | |||||||||| ||||||| |||||| |
|
|
| T |
5614827 |
ggggtttgaacccccgaccttacata-tattatgcattatccatatcaactgagttaagttcacga |
5614763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 6489077 - 6489001
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
6489077 |
tggtggccggggtttgaaccccagaccttgcata-tattatgcattgtccctaccaactgagctaagctcacgaggac |
6489001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 6624846 - 6624770
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| | ||||||||||| ||| ||||| || ||||||||||||||| |
|
|
| T |
6624846 |
tggtggccggggttcgaaccccggaccttgcata-tattatgcattgtccatgccaactgagctaagctcacgaggac |
6624770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Original strand, 9893670 - 9893738
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||||||| || ||||||||| || ||||||| ||||||| |
|
|
| T |
9893670 |
ggggtttgaaccccagaccttgcata-ttttatgcattatctatatcaactgagctaagctcgcgaggac |
9893738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 10531610 - 10531534
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| ||||||||||||||| |||||| | |||| | ||||||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
10531610 |
tggtagtcggggtttgaaccacggaccgtgcata-tattatgcattgtccatagcaactaaactaagctcacgaggac |
10531534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 18331777 - 18331701
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||| ||||||||||||| |||| ||| | || ||||||||| ||||| |
|
|
| T |
18331777 |
tggtggccggggcttgaaccccggaccttgcata-ttttatgcattgtccataccaagtgagctaagctcacaaggac |
18331701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 494
Target Start/End: Complemental strand, 20721121 - 20721053
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagct |
494 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| | ||||| ||||| |||| ||||| ||||||||| |
|
|
| T |
20721121 |
atggtagtcggggtttgaaccccggaccttgcata-tattatgtattgtccataccaactgagttaagct |
20721053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 28207202 - 28207126
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||| || ||||| |||||||| |||||||| |||||||||| ||| ||||| || ||||||||||||||| |
|
|
| T |
28207202 |
tggtggccgggattcgaacctcggaccttgcatatttt-atgcattgtccataccaactgagctaagctcacgaggac |
28207126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 34436921 - 34436845
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||||| |||| |||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
34436921 |
tggtgggcggggtttgaaccccggcccttgcata-tattatgcattgtccctaccaactgagctaagctcacgaggac |
34436845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 464
Target Start/End: Complemental strand, 37884733 - 37884696
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttt |
464 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
37884733 |
tggtggtcggggtttgaaccctggaccttacatctttt |
37884696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 37932400 - 37932324
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| | ||||| |||||||||||||| |||| | ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
37932400 |
tggtggccagggttcgaaccccggaccttgcata-tattatgcattgtccataccaactgagctaagctcacgaggac |
37932324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 475
Target Start/End: Complemental strand, 39529518 - 39529470
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||| ||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
39529518 |
atggtggccggagtttgaaccccg-accttgcatatttttatgcattgtc |
39529470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 40782538 - 40782615
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||||| ||||||||||| |||| |||| |||||| ||||||||||| |
|
|
| T |
40782538 |
tggtggccggggtttgaaccccataagttacatattattatgcattgtccatacaaactgagttaaactcacgaggac |
40782615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 496
Target Start/End: Complemental strand, 1488433 - 1488365
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctca |
496 |
Q |
| |
|
|||| |||| ||||||||||| | ||| |||||||||||||||||| |||| ||||| || |||||||| |
|
|
| T |
1488433 |
gtggccgggatttgaaccccgaatcttgcatatttttatgcattgtccataccaactgagctaagctca |
1488365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 498
Target Start/End: Original strand, 16579365 - 16579436
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||| | |||||||||| ||||| ||||| ||||||| ||||| |
|
|
| T |
16579365 |
tggtggtcagggtttgaaccacggaccttgcata-tattatgcattgttcataccaactgagttaagttcacg |
16579436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 502
Target Start/End: Original strand, 16701572 - 16701647
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| | |||| |||||| | || ||||| || |||||||||||||| |
|
|
| T |
16701572 |
tggtggtcggggtttgaatcccggaccttgcata-tattattcattgtccctaccaactgagctaagctcacgagga |
16701647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 26655534 - 26655487
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
26655534 |
tggtggccggggttcgaaccccggaccttacata-tattatgcattgtc |
26655487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 26927119 - 26927072
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
26927119 |
tggtggccggggttcgaaccccggaccttacata-tattatgcattgtc |
26927072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 32234831 - 32234785
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
32234831 |
tggtggtcggggtttgaacccc-gaccttgcata-ttttatgcattgtc |
32234785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 432 - 503
Target Start/End: Complemental strand, 38495207 - 38495136
Alignment:
| Q |
432 |
gtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||| | |||| ||||| ||||||| |||| ||||| |
|
|
| T |
38495207 |
gtcggggtttgaaccccgaaccttgcata-ttttatgcattatccataccaactgagttaagttcacaaggac |
38495136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 499
Target Start/End: Complemental strand, 42515876 - 42515805
Alignment:
| Q |
429 |
gtggtcggggtttgaa-ccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| | ||||||||||| |||| ||||| | |||||||||||| |
|
|
| T |
42515876 |
gtggccggggtttgaatccccggaccttacata-tattatgcattgtccataccaactgaattaagctcacga |
42515805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 51)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Complemental strand, 3708763 - 3708686
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
3708763 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
3708686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 11868653 - 11868730
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
11868653 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
11868730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 427 - 505
Target Start/End: Original strand, 35360046 - 35360123
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
35360046 |
tggtggccggggtttgaactccggaccttgcatatttt-atgcattgtcctaccaactaagctaagctcacgaggacga |
35360123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 20990895 - 20990968
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
20990895 |
tggtggtcggggtttgaaccctgaaccttgcata-ttttatgcattgtctataacaactaagttaagctcacgag |
20990968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 29798508 - 29798585
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||| ||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
29798508 |
tggtggtcggggttcgaacccctgaccttaaata-ttttatgcattgtccataccaactgagttaagctcacgaggacg |
29798585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 31815878 - 31815951
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||||||||| | || ||||| ||||||||||||||| |
|
|
| T |
31815878 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgtccctaccaactgagttaagctcacgag |
31815951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 34469863 - 34469939
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
34469863 |
tggtggtcggggttcgaaccccggaccttgcata-agctatgcattgttcttatcaactaagttaagctcacgaggac |
34469939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 435 - 503
Target Start/End: Original strand, 27906218 - 27906286
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
27906218 |
ggggtttgaactccggaccttgtatatttttatgcattgttcaatcaactgagctaagctcacgaggac |
27906286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 430 - 504
Target Start/End: Original strand, 11817339 - 11817414
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||| |||||| |||| ||||| ||||||||||| ||||||| |
|
|
| T |
11817339 |
tggtcggggttcgaacccctaaccttacatattattatacattgtccataccaactgagttaagctcatgaggacg |
11817414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 32063580 - 32063655
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||| | |||||| |||||||||||||||| | |||| ||||| || ||||||||||||||| |
|
|
| T |
32063580 |
gtggtcgaggtttgaacctctgaccttgcatatttttatgcattatccataccaactgagctaagctcacgaggac |
32063655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 430 - 504
Target Start/End: Original strand, 14414886 - 14414963
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttt--tatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||| ||||||||| || ||||||||||| || ||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
14414886 |
tggtcggagtttgaacctcgaaccttacatatattattatgcattgtccataccaactgagttaagctcacgaggacg |
14414963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 19976224 - 19976150
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||| |||| |||||||||||||| |||||| ||||||||||| |||| ||||| || ||| |||||||| |
|
|
| T |
19976224 |
tggtggtcgaggttcgaaccccggaccttgcatattattatgcattgtccataccaactgagctaaactcacgag |
19976150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 429 - 475
Target Start/End: Original strand, 28550477 - 28550523
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
28550477 |
gtggttggggtttgaatcccggaccttgcatatttttatgcattgtc |
28550523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 34977275 - 34977198
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||| ||| ||||||||| ||||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
34977275 |
atggtggccggggtttaaactccggaccttgcatatatt-atgcattgtccataccaactgagttaagctcacgaggac |
34977198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 35456811 - 35456889
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||| || |||||||| || || ||||| || |||||||||||||||| |
|
|
| T |
35456811 |
tggtggttggggtttgaaccccgaaccttgcatatattaatgcattgttcttaccaactgagctaagctcacgaggacg |
35456889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Original strand, 41187455 - 41187524
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||||||| || |||||||| |||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
41187455 |
cggggttcgaaccccggactttgcatatttt-atgcattgtccataccaactaagctaagctcacgaggac |
41187524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 41204492 - 41204569
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||||| || |||||||| | ||| |||||||||||||||||| |||| |||||||| ||||||||||| |||| |
|
|
| T |
41204492 |
tggtggtcgggattggaaccccg-agcttgcatatttttatgcattgtccataccaactaagctaagctcacgatgacg |
41204569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 2257041 - 2256965
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| ||||||| |||||| ||||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
2257041 |
tggtggccggggttcgaaccccagaccttgcatatatt-atgcattgtccataccaactgagttaagctcacgaggac |
2256965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 6765680 - 6765604
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| ||||| || |||||| || ||||| |
|
|
| T |
6765680 |
tggtggtcgtggttcgaaccccggaccttacata-ttttatgcattgtccataccaactgagctaagcttacaaggac |
6765604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 14735884 - 14735960
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||| ||||||||| || |||||||||| ||||||||||||| |||| ||| |||| ||||||||||||||| |
|
|
| T |
14735884 |
tggtggccggagtttgaacctcgaaccttacata-ttttatgcattgtccataccaattaagctaagctcacgaggac |
14735960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 21870886 - 21870962
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||| ||||||||||| |||| ||||| || | ||||||||||||| |
|
|
| T |
21870886 |
tggtggtcggggttcgaaccccgaaccttgcatattattatgcattgtccataccaact-agctgagctcacgaggac |
21870962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 25625786 - 25625710
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | ||||| ||||| |||| |||| | |||||||||||||||| |
|
|
| T |
25625786 |
tggtggtccgggtttgaaccccggaccttacata-tattatgaattgtccatacaaactgatttaagctcacgaggac |
25625710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 426 - 502
Target Start/End: Complemental strand, 41859923 - 41859847
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
||||||| ||||||||||||||| |||||| |||| ||||||||||||| |||| ||||| |||||| ||||| |||| |
|
|
| T |
41859923 |
atggtggccggggtttgaaccccagaccttgcata-ttttatgcattgtccataccaactgagttaaactcacaagga |
41859847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 494
Target Start/End: Original strand, 9547400 - 9547467
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagct |
494 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| | ||||||||||| |||||||||| ||||||||| |
|
|
| T |
9547400 |
tggtggtcggggtttgaaccccaaaccttgcata-tattatgcattgtccatatcaactgagttaagct |
9547467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 430 - 505
Target Start/End: Complemental strand, 29734758 - 29734683
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||||||||| |||||||| |||| | ||||||||||| |||||||||| || ||| ||||| ||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcata-tattatgcattgtccatatcaactgagctaaactcacaaggacga |
29734683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 41748747 - 41748794
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
41748747 |
tggtggtcggggtttgaatcccggatcttacata-ttttatgcattgtc |
41748794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 346117 - 346191
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcatt-gtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||||| ||| | ||||| || ||||||||||||||| |
|
|
| T |
346117 |
gtggtcggggtttgaaccctggaccttacata-tattatgcattattcaaaccaactgagctaagctcacgaggac |
346191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 464
Target Start/End: Complemental strand, 4180765 - 4180730
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttt |
464 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4180765 |
gtggtcggggtttgaaccccggaccttgcatatttt |
4180730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 504
Target Start/End: Complemental strand, 21929538 - 21929464
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| |||||||||| | ||||| || |||||||||||||||| |
|
|
| T |
21929538 |
gtggccggggtttgaacccctgaccttgtatatttt-atgcattgtccaaccaactgagctaagctcacgaggacg |
21929464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 497
Target Start/End: Original strand, 23250311 - 23250381
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcac |
497 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| | |||||||||| || || ||||| |||||||||||| |
|
|
| T |
23250311 |
tggtggtcggggtttgaaccctggaccttgcata-tattatgcattgttcttaccaactgagttaagctcac |
23250381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 501
Target Start/End: Original strand, 27412827 - 27412901
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgagg |
501 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| | |||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
27412827 |
tggtggtcggggtttgaacaacagaccttacata-tattatgcattgtctctaccaactgagttaagctcacgagg |
27412901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 27848228 - 27848154
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgca-ttgtc-atatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | ||||||| ||||| ||| ||||| ||||||||||||||| |
|
|
| T |
27848228 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcatttgtcaataccaactgagttaagctcacgag |
27848154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 7052837 - 7052767
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||||||| | || ||||| || |||||||||| |||| |
|
|
| T |
7052837 |
cggggtttgagccccggaccttgcatattattatgcattgtccttaccaactgagctaagctcacggggac |
7052767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 20565066 - 20565139
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| | ||||||||||| | || ||||| || |||||||||||| |
|
|
| T |
20565066 |
tggtggttggggtttgaaccccggaccttgcata-tattatgcattgtccctaccaactgagctaagctcacgag |
20565139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 475
Target Start/End: Complemental strand, 22709153 - 22709108
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||| |||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
22709108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 430 - 503
Target Start/End: Original strand, 42475104 - 42475177
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| ||||| | |||||| |||||||| ||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
42475104 |
tggtcggggttcgaacctcagaccttgcatatttt-atgcattgtttataccaactgagttaagctcacgaggac |
42475177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 44694751 - 44694682
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||| |||| |||| | |||||||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
44694751 |
cggggtttgaaccccgagccttgcata-tattatgcattgtctatatcaactgagttaagttcacgaggac |
44694682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 4557762 - 4557838
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| | |||||||||||| ||| ||||| | ||| ||||||||||| |
|
|
| T |
4557762 |
tggtggtcagggtttgaaccacggaccttacata-tattatgcattgtctataccaactttgctaatctcacgaggac |
4557838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 442 - 498
Target Start/End: Original strand, 9799415 - 9799472
Alignment:
| Q |
442 |
gaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
9799415 |
gaaccccgaaccttgcatatatttatgcattgtccatttcaactaagctaagctcacg |
9799472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 10735822 - 10735898
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | |||||||| || | || ||||| || ||||||||||||||| |
|
|
| T |
10735822 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcatcgtccctaccaactgagctaagctcacgaggac |
10735898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 499
Target Start/End: Original strand, 25186241 - 25186305
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||||||||||||| |||| | ||||||||||| |||||||||| || ||| ||||||| |
|
|
| T |
25186241 |
ggggtttgaaccccggaccttgcata-tattatgcattgtccatatcaactgagctaaactcacga |
25186305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 27411162 - 27411086
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| | ||||||| || |||||||||| || ||||||||||||||| |
|
|
| T |
27411162 |
tggtggccggggttcgaaccccggaccttgcata-tattatgcaaggtccatatcaactgagctaagctcacgaggac |
27411086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 31543082 - 31543006
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| | ||||||||| | |||| || || || ||||||||||||||| |
|
|
| T |
31543082 |
tggtggttggggtttgaaccccggaccttgcata-tattatgcattatccataccatctgagctaagctcacgaggac |
31543006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 33064056 - 33063980
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||| ||||| || |||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
33064056 |
tggtggccggagttcgaactccggaccttgcatatatt-atgcattgtccatatcaactgagctaagctcacgaggac |
33063980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 472
Target Start/End: Original strand, 33117403 - 33117440
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcatt |
472 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
33117403 |
ggggtttgaaccccggaccttatatattattatgcatt |
33117440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 429 - 497
Target Start/End: Original strand, 40853811 - 40853879
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcat-tgtcatatcaactaagttaagctcac |
497 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| | |||||||| | ||||||||||| || ||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcata-tattatgcatatttcatatcaactgagctaagctcac |
40853879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 44526198 - 44526122
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||| |||||||||| | || | ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgta-tattatgcattgtccataccaactgagctaagctcacgaggac |
44526122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 660813 - 660860
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| | |||||||||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcata-tattatgcattgtc |
660860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 436 - 491
Target Start/End: Complemental strand, 3904263 - 3904208
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaa |
491 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||| | ||||||||||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacata-tattatgcattgtccctatcaactaagttaa |
3904208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 502
Target Start/End: Complemental strand, 19967488 - 19967413
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
||||||||| ||||||||| ||| ||||| || || || ||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
19967488 |
tggtggtcgaggtttgaactccgaaccttgcacatatt-atgcattgttcatatcaactgagctaagctcacgagga |
19967413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 29544697 - 29544650
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
29544697 |
tggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
29544650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 161211 - 161135
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||||||||||| |||| ||||| |||||||||||| ||||| |
|
|
| T |
161211 |
tggtggtcggggtttgaaccccgaaccttgcata-ttttatgcattgtccataccaactgagttaagctcacaaggac |
161135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 499
Target Start/End: Complemental strand, 244550 - 244477
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||| ||| |||||| |||||||||||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
244550 |
tggtggtcgggattttaaccccaaaccttacatatttttatgcattgtccatatcaactgagctaagctcacga |
244477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 76)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 6423752 - 6423829
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| | |||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
6423752 |
tggtggccggggtttgaaccccggaccttgcatatataaatgcattgttcataccaactgagttaagctcacgaggac |
6423829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 499
Target Start/End: Complemental strand, 8736505 - 8736433
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| ||||||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
8736505 |
tggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtccataccaaccaagttaagctcacga |
8736433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 39452531 - 39452454
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||| ||| |||||| ||||||||||||||||| ||||| ||||| || ||||||||||||||| |
|
|
| T |
39452531 |
tggtggccggggtttgaatcccagaccttgcatatttttatgcattgttcataccaactgagctaagctcacgaggac |
39452454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 439 - 502
Target Start/End: Original strand, 8551430 - 8551493
Alignment:
| Q |
439 |
tttgaaccccggaccttacatatttttatgcattgtcatatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
8551430 |
tttgaaccccggaccttgcatatctttatgcattgtccaatcaactgagctaagctcacgagga |
8551493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 429 - 502
Target Start/End: Complemental strand, 2613790 - 2613717
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||| |||| ||||| || |||||||||||||| |
|
|
| T |
2613790 |
gtggtcggggttcgaaccccgaaccttacata-ttttatgcattgtccataccaactgagctaagctcacgagga |
2613717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 15892868 - 15892794
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |||||||||||| |
|
|
| T |
15892868 |
tggtggccagggtttgaacctcggaccttacatatttttatgcattgttcataccaactgaactaagctcacgag |
15892794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 24752638 - 24752715
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| ||||||| |||||| |||||| ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
24752638 |
tggtggccggggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggac |
24752715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 428 - 500
Target Start/End: Original strand, 29450973 - 29451046
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||||||| ||||| |||| ||||| |||||| ||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
29450973 |
ggtggtcgggggttgaatcccgaaccttgcatattattatgcattgtccataccaactgagttaagctcacgag |
29451046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 499
Target Start/End: Original strand, 48646716 - 48646789
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||| ||| |||||||||||||||||| |||||| ||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
48646716 |
tggtggccggagtttgaaccccggaccttgcatattattatgcattgtccatacaaactgagttaagctcacga |
48646789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 3693789 - 3693863
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| | |||||| ||||| ||||||||| || ||||||||||||||| |
|
|
| T |
3693789 |
gtggtcggggtttgaacctcagaccttacata-tattatgctttgtctatatcaactgagctaagctcacgaggac |
3693863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 429 - 499
Target Start/End: Complemental strand, 7550964 - 7550894
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
7550964 |
gtggtcggggttcgaatcccggaccttgtatatttt-atgcattgttcatatcaactgagttaagctcacga |
7550894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 497
Target Start/End: Original strand, 17917129 - 17917199
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcac |
497 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||| |||||||||| || ||| ||||| |
|
|
| T |
17917129 |
tggtggtcggggtttgaatcccgaaccttacata-ttttatgcattgtccatatcaactgagctaaactcac |
17917199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 427 - 497
Target Start/End: Complemental strand, 32962633 - 32962563
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcac |
497 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |||||||||||| ||||| ||||| ||||| |||||| |
|
|
| T |
32962633 |
tggtggtcggggtttgaaccctggaccttgcata-ttttatgcattgttcataccaactgagttatgctcac |
32962563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 442 - 503
Target Start/End: Original strand, 13778818 - 13778880
Alignment:
| Q |
442 |
gaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||| ||||| |||||||| || ||||||||||||| |||||||| |||||| |
|
|
| T |
13778818 |
gaaccccggaccttatatattattatgcatcgtccatatcaactaagctaagctcatgaggac |
13778880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 18091267 - 18091197
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| ||||||||||| || |||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
18091267 |
cggggttcgaaccccggactttgtatatatttatgcattgtccctatcaactgagttaagctcacgaggac |
18091197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 20006142 - 20006064
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||| ||||||| ||| | |||||| ||||||||||| ||| |||||| |||||| ||||||||||| |
|
|
| T |
20006142 |
atggtggtcggggttcaaaccccgaaccctgcatattattatgcattgtccatgtcaactgagttaatctcacgaggac |
20006064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 438 - 503
Target Start/End: Complemental strand, 26834579 - 26834514
Alignment:
| Q |
438 |
gtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| | ||||||||||| || ||||||||||||||| |
|
|
| T |
26834579 |
gtttgaaccccggacctgacata-ttttatgcatcgttcatatcaactgagctaagctcacgaggac |
26834514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 430 - 503
Target Start/End: Complemental strand, 29506894 - 29506821
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||| || ||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29506894 |
tggtcggggttcgaaccctggaccttgcatatatt-atgtattgtctataccaactaagttaagctcacgaggac |
29506821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 435 - 503
Target Start/End: Original strand, 14907034 - 14907103
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| ||||||||||||| |||| ||||| ||||| ||| | |||||||||||||||||| |
|
|
| T |
14907034 |
ggggttcgaacccccgaccttacatattattatacattgttcataccaattgagttaagctcacgaggac |
14907103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 17139508 - 17139584
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
17139508 |
tggtggtcggggtttgaaccccggaccttgaata-tattatgcattgtccctaccaactgagctaagctcacgaggac |
17139584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 437 - 505
Target Start/End: Complemental strand, 26755676 - 26755608
Alignment:
| Q |
437 |
ggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatata-atgcattgtccatatcaactgagctaagctcacgaggacga |
26755608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 33153871 - 33153947
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| | ||||||||||| | || ||||| |||||||||||| ||||| |
|
|
| T |
33153871 |
tggtgttcggggtttgaacctcggaccttacata-tattatgcattgtccctaccaactgagttaagctcacaaggac |
33153947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 444 - 503
Target Start/End: Original strand, 925434 - 925494
Alignment:
| Q |
444 |
accccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| | |||||||| |||||| |
|
|
| T |
925434 |
accccggaccttgcatatttttatgcattgtccatatcaactgaactaagctcaggaggac |
925494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 498
Target Start/End: Complemental strand, 10293006 - 10292935
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacg |
498 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| | ||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
10293006 |
tggtggtcggggtttaaaccccgtcccttacata-tattatgcattgtccctatcaactgagttaagctcacg |
10292935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 429 - 504
Target Start/End: Complemental strand, 18166670 - 18166595
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||||||||||||||||||||| || |||| | |||||||||||| ||| ||||| || ||||| |||||||||| |
|
|
| T |
18166670 |
gtggtcggggtttgaaccccggactttgcata-tattatgcattgtctataccaactgagctaagcccacgaggacg |
18166595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 498
Target Start/End: Original strand, 32433086 - 32433157
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgca-ttgtcatatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||| ||||||||| || ||||||| ||| ||||||||||||| |
|
|
| T |
32433086 |
tggtggtcggggttcgaaccccgaaccttatata-ttttatgcatttttcatatcgactgagttaagctcacg |
32433157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 428 - 503
Target Start/End: Complemental strand, 37037417 - 37037341
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||| ||||| || ||||| |||||| |||| |||| || ||| ||||| |||||||||||||||||| |
|
|
| T |
37037417 |
ggtggtcggggttcgaaccacgaaccttgcatattattatacattatccataccaactcagttaagctcacgaggac |
37037341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 430 - 505
Target Start/End: Complemental strand, 37050996 - 37050921
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcatt-gtcatatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||||| ||||| ||| | ||||||||||||| |||||| |
|
|
| T |
37050996 |
tggtcggggttcgaaccccggaccttgcata-ttttatgcattattcataccaattgagttaagctcacgtggacga |
37050921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 40734996 - 40735043
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
40734996 |
tggtggtcagggtttgaaccccgaaccttacata-ttttatgcattgtc |
40735043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 435 - 475
Target Start/End: Complemental strand, 52494119 - 52494079
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
52494119 |
ggggtttgaacctcggaccttgcatatttttatgcattgtc |
52494079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 499
Target Start/End: Complemental strand, 1605456 - 1605394
Alignment:
| Q |
437 |
ggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcata-ttttatgcattgtccatactaactaagctaagctcacga |
1605394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 497
Target Start/End: Complemental strand, 11410697 - 11410627
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcac |
497 |
Q |
| |
|
||||||||||| || ||||||| ||||||||||| ||||||| |||| ||||| ||||| |||||||||||| |
|
|
| T |
11410697 |
tggtggtcgggattcgaaccccagaccttacata-ttttatgtattgttcataccaactgagttaagctcac |
11410627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 428 - 475
Target Start/End: Complemental strand, 13401666 - 13401620
Alignment:
| Q |
428 |
ggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacata-tattatgcattgtc |
13401620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Original strand, 41763148 - 41763222
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| |||||||||||||||||||||| |||| ||||||||||| | | || ||||| || ||||||||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcata-ttttatgcattatccctaccaactgagctaagctcacgaggac |
41763222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 503
Target Start/End: Complemental strand, 52267832 - 52267758
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgtcat-atcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| |||||| ||| |||||| |||||||| |||||||||| | | ||||| |||||||||||||||||| |
|
|
| T |
52267832 |
gtggtcgggatttgaatcccagaccttgcatatttt-atgcattgtccttaccaactgagttaagctcacgaggac |
52267758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Original strand, 8269359 - 8269393
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8269359 |
tggtggtcggggtttgaaccccggaccttgcatat |
8269393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 500
Target Start/End: Original strand, 11181926 - 11181999
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgag |
500 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||| ||| ||||||||| |||| ||| |||| |||||||||||| |
|
|
| T |
11181926 |
tggtggccggggtttgaaccccgcaccttgcata-tttcatgcattgtccataccaattaagctaagctcacgag |
11181999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 510
Target Start/End: Complemental strand, 11702034 - 11701953
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacgactaag |
510 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||| ||||||||||||| | | ||||| | |||||||||||||||| |||||| |
|
|
| T |
11702034 |
gtggtcagggtttgcaccctggaccttacata-ttttatgcattgtcccaaccaactgaattaagctcacgaggacaactaag |
11701953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 503
Target Start/End: Complemental strand, 13590180 - 13590104
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||| ||||||||||||| || | ||||| || ||||||||||||||| |
|
|
| T |
13590180 |
atggtggtcggg-tttgaactccgaaccttacata-ttttatgcattgtccaaaccaactgagctaagctcacgaggac |
13590104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 504
Target Start/End: Original strand, 16967185 - 16967262
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||||| ||| ||||||||| || ||||| ||||| || |||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
16967185 |
tggtggccggagtttgaacctcgaaccttgcatatatt-atgcattgtccatatcaactaagctaagctcacgaagacg |
16967262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Original strand, 21965889 - 21965959
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcatt-gtcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||| ||||||||||| || ||||||||| ||||| |
|
|
| T |
21965889 |
cggggttcgaaccccggaccttgtatatatttatgcattattcatatcaactgagctaagctcacaaggac |
21965959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 25533036 - 25532967
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||||||| |||| | ||||||||||| |||| ||||| | ||||||||||||||| |
|
|
| T |
25533036 |
cggggtttgaaccccggaccttgcata-tattatgcattgtccataccaactgaactaagctcacgaggac |
25532967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 504
Target Start/End: Complemental strand, 27533313 - 27533236
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| | ||||||||||| | || ||||| | |||||||||||||||| |
|
|
| T |
27533313 |
tggtggtcggggtttgaaccccgaaccttgcata-tattatgcattgtccctaccaactgatctaagctcacgaggacg |
27533236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 462 - 503
Target Start/End: Complemental strand, 41032967 - 41032925
Alignment:
| Q |
462 |
ttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
41032967 |
ttttatgcattgttcatatcaactgagttaagctcacgaggac |
41032925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Original strand, 49431984 - 49432018
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
49431984 |
tggtggccggggtttgaaccccggaccttacatat |
49432018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 1091249 - 1091173
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||| | |||||||||||| ||||| |||| || |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
1091249 |
tggtggtcagagtttgaaccccgaaccttgcatacatt-atgcattgtctataccaactgagttaagctcacgaggac |
1091173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 1794666 - 1794590
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| ||||||||||||||| ||| |||| | ||||||||||| |||| |||| || ||||||||||||||| |
|
|
| T |
1794666 |
tggtggtcgaggtttgaaccccggatcttgcata-tattatgcattgtccatactaactgagctaagctcacgaggac |
1794590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Complemental strand, 2209284 - 2209211
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| | ||||||||| || || |||| |||||||||||||| |
|
|
| T |
2209284 |
tggtggtcggggtttgaagcccggacctagcatatatatatgcattgttcctactaactgagttaagctcacga |
2209211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 429 - 474
Target Start/End: Original strand, 12268977 - 12269021
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | ||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
12269021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Complemental strand, 15668560 - 15668492
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| || | ||||| ||||||| |||||||||| |
|
|
| T |
15668560 |
ggggtttgaaccccggaccttgcata-ttttatgcattgttccaaccaactgagttaagatcacgaggac |
15668492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 16033441 - 16033517
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||| ||||||||||| |||||| |||| | ||||||||||| | |||||||| ||| |||||||||||||| |
|
|
| T |
16033441 |
tggtggccggagtttgaaccccagaccttgcata-tattatgcattgtccctatcaactgagtcaagctcacgaggac |
16033517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 429 - 474
Target Start/End: Complemental strand, 23203390 - 23203346
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt |
474 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
23203390 |
gtggtcggggtttgaaccccgaaccttgcata-ttttatgcattgt |
23203346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 24162752 - 24162829
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| | |||||||||| ||| ||||| || ||||||||||||||| |||| |||| || ||||||||||||||| |
|
|
| T |
24162752 |
tggtggccagggtttgaactccgaaccttgcaaatttttatgcattgtccataccaacagagctaagctcacgaggac |
24162829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 24529755 - 24529679
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||| || ||||||||||||||||||| ||||||||| ||| |||| |||| ||||||||||| |||||| |
|
|
| T |
24529755 |
tggtggccgggattcgaaccccggaccttacata-ttttatgcaatgtccatactaactgagttaagctcatgaggac |
24529679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 437 - 505
Target Start/End: Complemental strand, 29739397 - 29739329
Alignment:
| Q |
437 |
ggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| | || ||||| || |||||| |||||||||| |
|
|
| T |
29739397 |
ggtttgaaccccggaccttgcata-ttttatgcattgtccttaccaactgagctaagctaacgaggacga |
29739329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 507
Target Start/End: Complemental strand, 30521925 - 30521857
Alignment:
| Q |
439 |
tttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggacgact |
507 |
Q |
| |
|
|||||| |||||||||| ||||| || |||||||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
30521925 |
tttgaatcccggaccttgcatatatt-atgcattgctcctttcaactgagttaagctcacgaggacgact |
30521857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 32944806 - 32944730
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||| ||||||| ||| || |||| | ||||||||||| |||| |||||||| ||||||||| ||||| |
|
|
| T |
32944806 |
tggtggtcggggttcgaaccccagacgttgcata-tattatgcattgtccataccaactaagctaagctcacaaggac |
32944730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 32950752 - 32950828
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||| || ||||||||| ||| ||||| ||||||||||||| |||| |
|
|
| T |
32950752 |
tggtggtcgaggtttgaactccggaccttgcatatatt-atgcattgtttataccaactgagttaagctcacgtggac |
32950828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 499
Target Start/End: Original strand, 39252248 - 39252320
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacga |
499 |
Q |
| |
|
||||||| || |||||||||| |||||||||||| | ||||| |||||| ||||||||| || ||||||||||| |
|
|
| T |
39252248 |
tggtggttggagtttgaaccctggaccttacata-tattatgtattgtcgatatcaactgagctaagctcacga |
39252320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 460
Target Start/End: Original strand, 40411744 - 40411777
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacata |
460 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
40411744 |
tggtggtcggggtttgaaccctggaccttacata |
40411777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Complemental strand, 41973325 - 41973249
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| | ||||||||||| | || ||| |||||||||||| ||||||| |
|
|
| T |
41973325 |
tggtggccggggttcgaaccccggaccttgcata-tattatgcattgtccctaccaattaagttaagctcgcgaggac |
41973249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 42045363 - 42045439
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||| || |||||| |||| | ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
42045363 |
tggtggccggggtttgaactccagaccttgcata-tattatgcattgtccataccaactgagctaagctcacgaggac |
42045439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Complemental strand, 42888637 - 42888569
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||| |||| ||||| || |||||||||| |||| |
|
|
| T |
42888637 |
ggggttcgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgtggac |
42888569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 506
Target Start/End: Complemental strand, 48100793 - 48100713
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacgac |
506 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||| ||||||||||||| |||| ||||| || ||||||||| |||||||| |
|
|
| T |
48100793 |
atggtggtcaaggtttgaaccccaaaccttgcata-ttttatgcattgtccataccaactgagctaagctcacaaggacgac |
48100713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 472
Target Start/End: Original strand, 51811336 - 51811381
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcatt |
472 |
Q |
| |
|
||||||||||| ||||||||| | ||||| |||||||||||||||| |
|
|
| T |
51811336 |
tggtggtcgggatttgaaccctgaaccttgcatatttttatgcatt |
51811381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 435 - 503
Target Start/End: Complemental strand, 1603735 - 1603665
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaa--gctcacgaggac |
503 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| |||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
1603735 |
ggggtttgaactccggaccttacata-ttttatatattgtctatatcaactgagttaagcgctcacgaggac |
1603665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 461
Target Start/End: Complemental strand, 2994826 - 2994794
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatat |
2994794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 435 - 475
Target Start/End: Complemental strand, 9574853 - 9574813
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
9574853 |
ggggttcgaacccgggaccttacatatatttatgcattgtc |
9574813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 498
Target Start/End: Original strand, 17651371 - 17651442
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacg |
498 |
Q |
| |
|
|||||| | ||||||||||| | |||||| |||||||| ||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
17651371 |
tggtggccagggtttgaacctcagaccttgcatatttt-atgtattgtccatatcaacttagttaagctcacg |
17651442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 426 - 470
Target Start/End: Original strand, 19795106 - 19795150
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgca |
470 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
19795106 |
atggtggccggggtttgaaccccggaccttgcatatattaatgca |
19795150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 444 - 503
Target Start/End: Original strand, 28568842 - 28568902
Alignment:
| Q |
444 |
accccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||| || ||||| ||||||||||| || ||||| || |||||||||||||||||| |
|
|
| T |
28568842 |
accccggactttgcatatatttatgcattgttcctatcagctgagttaagctcacgaggac |
28568902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 464 - 499
Target Start/End: Original strand, 29701347 - 29701383
Alignment:
| Q |
464 |
ttatgcattgtc-atatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29701347 |
ttatgcattgtccatatcaactaagttaagctcacga |
29701383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 430 - 505
Target Start/End: Complemental strand, 29800600 - 29800525
Alignment:
| Q |
430 |
tggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggacga |
505 |
Q |
| |
|
|||| |||||||||||||| |||||| |||| ||||||||||| | | || ||||| ||||||||||||||| |||| |
|
|
| T |
29800600 |
tggttggggtttgaacccccgaccttgcata-ttttatgcattatccttaccaactgagttaagctcacgagaacga |
29800525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 33491155 - 33491107
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
||||||||||| || |||||||| ||||| |||||| |||||||||||| |
|
|
| T |
33491155 |
tggtggtcgggattcgaaccccgaaccttgcatattattatgcattgtc |
33491107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 448 - 503
Target Start/End: Original strand, 43840337 - 43840392
Alignment:
| Q |
448 |
cggaccttacatatttttatgcattgtc-atatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
43840337 |
cggatcttacatatttt-atgcattgtccatatcaactgagttaaactcacgaggac |
43840392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 502
Target Start/End: Complemental strand, 51046212 - 51046137
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||||||| ||| |||| ||| |||||||||| ||||||| |||| ||||| ||||| |||||| |||||||||| |
|
|
| T |
51046212 |
tggtggtcggagttcgaactccgaaccttacata-ttttatgtattgttcataccaactgagttaaactcacgagga |
51046137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 22974 - 22905
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
22974 |
cggggtttgaacctcggaccttgcata-ttttatgcattgttcatatcaactaaactaagctcacgaggac |
22905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0458 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0458
Description:
Target: scaffold0458; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 427 - 503
Target Start/End: Original strand, 11142 - 11219
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| ||||||||||| ||| |||||| |||||||||||||||||| |||| ||||| | ||||||||||||||| |
|
|
| T |
11142 |
tggtggccggggtttgaatcccagaccttgcatatttttatgcattgtccataccaactgatctaagctcacgaggac |
11219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 502
Target Start/End: Original strand, 53371 - 53446
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgagga |
502 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| ||||||||||||| | | ||||| ||||||||||||||||| |
|
|
| T |
53371 |
tggtggtcggggtttgaaccccagaccttgcata-ttttatgcattgtcccttccaactgagttaagctcacgagga |
53446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 221 - 151
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
||||||| |||||||||||| |||||| ||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
221 |
cggggttcaaaccccggacctgacatatatttgtgcattgttcctatcaactgagttaagctcacgaggac |
151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 503
Target Start/End: Complemental strand, 1702 - 1641
Alignment:
| Q |
443 |
aaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||| || |||||||| ||| |||||||||||||| |
|
|
| T |
1702 |
aaccccggacctgacatatatttgtgcattgttcctatcaactgagtaaagctcacgaggac |
1641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 434 - 503
Target Start/End: Complemental strand, 185326 - 185257
Alignment:
| Q |
434 |
cggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
185326 |
cggggtttgaaccccggatcttgcata-ttttatgcattgtccataccaactgagctaagctcacgaggac |
185257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 495
Target Start/End: Complemental strand, 7792 - 7724
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctc |
495 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| ||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
7792 |
tggtggtcggggtttgaacctcggaccttgcat-gttttatgcattgtccataccaactgagttaagctc |
7724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 464
Target Start/End: Complemental strand, 39454 - 39417
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttt |
464 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39454 |
tggtggtcggggtttgaaccccagaccttacatatttt |
39417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 500
Target Start/End: Complemental strand, 37606 - 37532
Alignment:
| Q |
426 |
atggtggtcggggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgag |
500 |
Q |
| |
|
||||||| |||| || |||||||||||||| |||| |||||||||||| ||||| ||||| || |||||||||||| |
|
|
| T |
37606 |
atggtggccgggattcgaaccccggaccttgcata-ttttatgcattgttcataccaacttagctaagctcacgag |
37532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 499
Target Start/End: Complemental strand, 75252 - 75181
Alignment:
| Q |
429 |
gtggtcggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacga |
499 |
Q |
| |
|
|||||||||||| |||| | ||||||| |||||| ||||||||| | |||| ||||| |||||||||||||| |
|
|
| T |
75252 |
gtggtcggggttcgaactctggaccttgcatattattatgcattatccataccaactgagttaagctcacga |
75181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 504
Target Start/End: Complemental strand, 99107 - 99030
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtca-tatcaactaagttaagctcacgaggacg |
504 |
Q |
| |
|
|||| ||||| ||||||||||| |||||| ||||| || |||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
99107 |
tggttgtcggagtttgaaccccagaccttgcatatatt-atgcattgtccctatcaactgagtcaagctcacgaggacg |
99030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 435 - 503
Target Start/End: Complemental strand, 1590 - 1522
Alignment:
| Q |
435 |
ggggtttgaaccccggaccttacatatttttatgcattgt-catatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||| |||| ||||| || |||||||||| |||| |
|
|
| T |
1590 |
ggggttcgaaccccggaccttgcata-ttttatgcattgtccataccaactgagctaagctcacgtggac |
1522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 475
Target Start/End: Complemental strand, 7050 - 7002
Alignment:
| Q |
427 |
tggtggtcggggtttgaaccccggaccttacatatttttatgcattgtc |
475 |
Q |
| |
|
|||||| |||| || ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
7050 |
tggtggccgggattcgaaccccagaccttacatattattatgcattgtc |
7002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 436 - 503
Target Start/End: Complemental strand, 118880 - 118813
Alignment:
| Q |
436 |
gggtttgaaccccggaccttacatatttttatgcattg-tcatatcaactaagttaagctcacgaggac |
503 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||||||| ||| | ||||| || ||||||||||||||| |
|
|
| T |
118880 |
gggtttgaactccagaccttacata-ttttatgcattgttcaaaccaactgagctaagctcacgaggac |
118813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University