View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10320_low_21 (Length: 229)
Name: NF10320_low_21
Description: NF10320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10320_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 6 - 223
Target Start/End: Original strand, 17302122 - 17302338
Alignment:
| Q |
6 |
agtggggtgaacttgaagagagtttgcctcaggaatcttagaagattgttgtatactgtcgttgtgtgctttatttgtcattttggtaacttttctaagg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17302122 |
agtggggtgaacttgaagagagtttgcctcaggaatcttaaaagattgttgtatactgtcgttgtgtgctttatttgtcattttggtaacttttctaagg |
17302221 |
T |
 |
| Q |
106 |
aactgatgaatcatgaagcttattttatttgcctctttcaaatgcattatctcaatcgtcnnnnnnnnnaggaaacctaggaagcatgaatacagatagg |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
17302222 |
aattgatgaatcatgaagcttattttatttgcctctttcaaatgcattatctcaatcgtc-ttttttttaggaaacctaggaagcaagaatacggatagg |
17302320 |
T |
 |
| Q |
206 |
gacacccgacacgacact |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17302321 |
gacacccgacacgacact |
17302338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University