View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10320_low_22 (Length: 227)

Name: NF10320_low_22
Description: NF10320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10320_low_22
NF10320_low_22
[»] chr4 (2 HSPs)
chr4 (1-227)||(38742604-38742830)
chr4 (135-172)||(38742873-38742910)
[»] chr5 (1 HSPs)
chr5 (26-59)||(1301168-1301201)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 38742830 - 38742604
Alignment:
1 agaagctggtggatgttgctgccaaagtatcaattgaaattgtcgtgttcaatatcttaatttgaagaaaatattgagcactagtatatcttttccatat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38742830 agaagctggtggatgttgctgccaaagtatcaattgaaattgtcgtgttcaatatcttaatttgaagaaaatattgagcactagtatatcttttccatat 38742731  T
101 gttctttttaataacttacgtcacgggtcttcatatcatttcgtgtggaatgcataatgttaatgaaagttcccatcat-nnnnnnnnnttgctattaaa 199  Q
    |||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||| |||| ||          |||||||||||    
38742730 gttctttttaataacttacgtcaacggtcttcatctcatttcgtgtggaatgcataatgttaatgaaagtt-ccataataaaaaaaaaattgctattaaa 38742632  T
200 agtaaacaatcataatatataaatgaat 227  Q
    ||||||||||||||||||||||||||||    
38742631 agtaaacaatcataatatataaatgaat 38742604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 38742873 - 38742910
Alignment:
135 atcatttcgtgtggaatgcataatgttaatgaaagttc 172  Q
    ||||||||||||||||||||||||||||||||||||||    
38742873 atcatttcgtgtggaatgcataatgttaatgaaagttc 38742910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 1301201 - 1301168
Alignment:
26 agtatcaattgaaattgtcgtgttcaatatctta 59  Q
    ||||||||||||||||||||||||||||||||||    
1301201 agtatcaattgaaattgtcgtgttcaatatctta 1301168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University