View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10320_low_8 (Length: 354)
Name: NF10320_low_8
Description: NF10320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10320_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 35004990 - 35004649
Alignment:
| Q |
1 |
tagaaaaacaaaagtccttccaattaaccccacccacttgaacctatggttaannnnnnngtttctcattacctcttcttcattcatcaaccttaattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004990 |
tagaaaaacaaaagtccttccaattaaccccacccacttgaacctatggttaatttttttgtttctcattacctcttcttcattcatcaaccttaattca |
35004891 |
T |
|
| Q |
101 |
aatctctctaataaccttatttaaaaatttaat---tatttctcttttgtcaagcctggctaattcttatttcattgaatgttcatggcaccaaggaggg |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004890 |
aatctctctaataacctcatttaaaaatttaataattatttctcttttgtcaagcctggctaattcttatttcattgaatgttcatggcaccaaggaggg |
35004791 |
T |
|
| Q |
198 |
gcctattggatggaggagaggaccgttatggattaatgtcttttggcaccaaagacattttcactatgcgacgtaaaataagatattggcaaaaacaatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004790 |
gcctattggatggaggagaggaccgttatggattaatgtcttttggcaccaaagacattttcactatgcgacgtaaaataagatattggcaaaaacaatt |
35004691 |
T |
|
| Q |
298 |
caagcaacgacatttatttggggggttaatggttcttctttt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004690 |
caagcaacgacatttatttggggggttaatggttcttctttt |
35004649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University