View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10321_low_2 (Length: 407)
Name: NF10321_low_2
Description: NF10321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10321_low_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 18 - 407
Target Start/End: Original strand, 40021169 - 40021558
Alignment:
| Q |
18 |
agtggccgattgtagcagcgggagcaggaactacagtagcagtttttggtgcagctgcgttgatctatgtgtactgcgccaaacggaggtgatttttctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021169 |
agtggccgattgtagcagcgggagcaggaactacggtagcagtttttggtgcagctgcgttgatctatgtgtactgcgccaaacggaggtgatttttctg |
40021268 |
T |
|
| Q |
118 |
tgatgtgggaatacgaatgggagggtgtagaggttagattacaagtctttttactcacaaatatgcttcaattttgttagtcatgaaataatgatgcttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021269 |
tgatgtgggaatacgaatgggagggtgtagaggttagattacaagtctttttactcacaaatatgcttcaattttgttagtcatgaaataatgatgcttc |
40021368 |
T |
|
| Q |
218 |
tatggcttttgtttttgaagcctttttgatatatgtcaaagttggcatactggtttggttgttggttgcttgttgaggattaaaactattgtgtgttaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021369 |
tatggcttttgtttttgaagcctttttgatatatgtcaaagttggcatactggtttggttgttggttgcttgttgaggattaaaactattgtgtgttaag |
40021468 |
T |
|
| Q |
318 |
agcaatgctctgattaactgcagttactaggtttatgctgtagtgattacaagtctattatagttgcttaatagaatgtaaaattgaaat |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021469 |
agcaatgctctgattaactgcagttactaggtttatgctgtagtgattacaagtctattatagttgcttaatagaatgtaaaattgaaat |
40021558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University