View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10321_low_4 (Length: 254)
Name: NF10321_low_4
Description: NF10321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10321_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 40021820 - 40021602
Alignment:
| Q |
14 |
cacagagaatatgaaatacaggagctaccaagtcagcctccttgaacagccaaaagtgctgttgttaacctccacaacacaaacaggtaaggattaaatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021820 |
cacagagaatatgaaatacaggagctaacaagtcagcctccttgaacagccaacagtgctgttgttaacctccacaacacaaacaggtaaggattaaatt |
40021721 |
T |
|
| Q |
114 |
aaactaagtggctgtttggaaccacattaaaaaaggctggtaaacgcactattaatgcaaagctcaaaattgcagctttagaaatttcttagacgcacaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021720 |
aaactaagtggctgtttggaaccacgttaaaaaaggctggtaaacgcactattaatgcaaagctcaaaattgcagctttagaaatttcttagacgcacaa |
40021621 |
T |
|
| Q |
214 |
caacgggacgtggggaata |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40021620 |
caacgggacgtggggaata |
40021602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University