View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10322_high_5 (Length: 273)
Name: NF10322_high_5
Description: NF10322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10322_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 181
Target Start/End: Original strand, 31118598 - 31118761
Alignment:
| Q |
19 |
tttttggtcctaaggatccatccaccacttcatcttcttccaacagcatctttagctccatttttccacctccatccactgtatgcatgatttcctctcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118598 |
tttttggtcctaaggatccatccaccacttcatcttcttccaacagcatctttagctccatttttccacctccatccactgtatgcatgatttcctctcc |
31118697 |
T |
 |
| Q |
119 |
cttatat-aannnnnnnncatgcatggatatattttgctcatttatgcatgtcccttcaagact |
181 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118698 |
cttatataaattttttttcatgcatggatatattttgctcatttatgcatgtcccttcaagact |
31118761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 210 - 264
Target Start/End: Original strand, 31118790 - 31118844
Alignment:
| Q |
210 |
cagattgtgtattagttttagaaatatgtcatagatattgtttctaagttcttct |
264 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118790 |
cagattgtgtattagttttggaaatatgtcatagatattgtttctaagttcttct |
31118844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University