View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10322_high_6 (Length: 267)
Name: NF10322_high_6
Description: NF10322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10322_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 31 - 242
Target Start/End: Original strand, 45360413 - 45360624
Alignment:
| Q |
31 |
cgcccaagttgagcttgacacgaatattttccagaaaatcatactaacactcttcatgttagtgtaatgtaataatctttacagtatccattagcctatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360413 |
cgcccaagttgagcttgacacgaatattttccagaaaatcatactaacactcttcatgttagtgtaatgtaataatctttacagtatccattagcctatt |
45360512 |
T |
|
| Q |
131 |
gcttgttgaccttattgttgatgactactacattttatgttggaatgtttagtgataacttataagcacgttgggagtattgaatcaactagtaatgaaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45360513 |
gcttgttgaccttattgttgatgactactacattttatgttggaatgtttagtgataacttataagcacgttgggagtattgaatcaactagtaatgaaa |
45360612 |
T |
|
| Q |
231 |
gtttttaaatgc |
242 |
Q |
| |
|
||||| |||||| |
|
|
| T |
45360613 |
gttttaaaatgc |
45360624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University