View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10322_high_8 (Length: 242)
Name: NF10322_high_8
Description: NF10322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10322_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 22313007 - 22312783
Alignment:
| Q |
1 |
cggtgttttggtacatatgctttactgtttcggtggtcagtaccaaatgactaaaataacctttcttttggggtattatagtcattctagcacttttt-c |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22313007 |
cggtgttttggtacatatgctttactgtttcggtggtcagtgccaaatgactaaaataacctttcttttggggtattatagtcattctagcacttttttc |
22312908 |
T |
|
| Q |
100 |
actttagtactttgagggtatgttagtaattatctatcttatagaaaaatacataattccggaaaatgtggatttatagtcagaagaaacatctttaaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22312907 |
actttagtactttgagggtatgttagtaattatctatcttatagaaaaatacataattccggaaaatctggatttatagtcagaagaaacatctttaaca |
22312808 |
T |
|
| Q |
200 |
gttccatacctatgttaggtcacac |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22312807 |
gttccatacctatgttaggtcacac |
22312783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University