View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10322_low_9 (Length: 251)
Name: NF10322_low_9
Description: NF10322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10322_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 31118835 - 31119051
Alignment:
| Q |
1 |
aagttcttctaacttttgacctagctactggtatttcatcttaaactaactgttctacaccataaaaccattgtagatgatctatgtccctatttaggga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118835 |
aagttcttctaacttt-gacctagctactggtatttcatcttaaactaactgttctacaccataaaaccattgtagatgatctatgtccctatttaggga |
31118933 |
T |
|
| Q |
101 |
gggacacttcccatagctatggggtagtcatggcaaccccaaaacaattaaaatagtataaaccatatatacgtatatacaagttgtaagttaattattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31118934 |
gggacacttcccatagctatggggtagtcatggcaaccccaaaacaattaaaatagtataaaccatatatacgtatatacaagttgtaagttaattattt |
31119033 |
T |
|
| Q |
201 |
aacttacttttaaaatgt |
218 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
31119034 |
aacttactcttaaaatgt |
31119051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University